G422353


Basic Information

Item Value
gene id G422353
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 6630578 ~ 6630875 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU485081
NNNNNATAATGACCCCAAACACACCTCCAAGACGACCACTGCCTTGCTAAAGAATGTCTCCAGACCTAAACCCTATTGAGCATCTGTGGGGCATCCTCAAATGGAAGGTGGAGGAGCGCAAGGTCTCTAACATCCACCAGCTCCGTGATGTTGTCATGGAGGAGTGGAAGAGGACTCCAGTGGCAACCTGTGAAGCTCTGGTGAACTCCATGCCCAAGAGGGTTAAGGCAGTGCTGGAAAATAATGGTGGCCACACAAAATATTGACACTTTGGGCCCAATTTGGACATTTTCACTTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU485081 True 298 lncRNA 0.48 1 6630578 6630875

Neighbor

gene id symbol gene type direction distance location
CI01000304_06515961_06519125 NA coding downstream 111453 6515896 ~ 6519125 (-)
CI01000304_06507688_06509486 NA coding downstream 120956 6507542 ~ 6509622 (-)
CI01000304_06489010_06490993 NA coding downstream 138384 6488028 ~ 6492194 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 coding downstream 146592 6480743 ~ 6483986 (-)
CI01000304_06473293_06476260 NA coding downstream 154212 6473293 ~ 6476366 (-)
CI01000304_06659869_06667425 NA coding upstream 28949 6659824 ~ 6667499 (-)
CI01000304_06706476_06715064 GGCX coding upstream 75195 6706070 ~ 6715064 (-)
CI01000304_06725873_06727044 NA coding upstream 94824 6725699 ~ 6727044 (-)
CI01000304_06738434_06742551 STOML2.L, STOML2, STML2 coding upstream 107379 6738254 ~ 6742551 (-)
CI01000304_06867535_06870134 NA coding upstream 236242 6867117 ~ 6870134 (-)
G422343 NA non-coding downstream 18461 6611768 ~ 6612117 (-)
G422332 NA non-coding downstream 69861 6560486 ~ 6560717 (-)
G422331 NA non-coding downstream 70569 6559787 ~ 6560009 (-)
G422321 NA non-coding downstream 111133 6510991 ~ 6519445 (-)
G422318 NA non-coding downstream 129547 6500719 ~ 6501031 (-)
G422355 NA non-coding upstream 776 6631651 ~ 6633786 (-)
G422357 NA non-coding upstream 4958 6635833 ~ 6636140 (-)
G422359 NA non-coding upstream 6351 6637226 ~ 6637448 (-)
G422373 NA non-coding upstream 56053 6686928 ~ 6687167 (-)
G422420 NA non-coding upstream 276510 6907385 ~ 6970870 (-)
CI01000304_04661808_04672936 PPWD1 other downstream 1957631 4661766 ~ 4672947 (-)
CI01000304_04263955_04264962 NA other downstream 2365377 4263846 ~ 4265201 (-)
G419354 NA other downstream 4364337 2262502 ~ 2266241 (-)
G419353 NA other downstream 4394472 2229384 ~ 2236106 (-)
G422354 NA other upstream 211 6631086 ~ 6631499 (-)
G422378 NA other upstream 113804 6744679 ~ 6783046 (-)
G422810 NA other upstream 999284 7630159 ~ 7652703 (-)
G423386 NA other upstream 2231348 8862223 ~ 8865296 (-)
CI01000304_09566730_09575706 NA other upstream 2937481 9566730 ~ 9575706 (-)

Expression


Co-expression Network