G422429


Basic Information

Item Value
gene id G422429
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 6972031 ~ 6972231 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU485175
AGGGGAGAGCGGGGCACAACCTAACGCTTTTTGACTTTCTCAGTTTGTGTAAATCTACTTAGGGTTCAGGGAATTTCTTTTGTTCCACATTAATTTCACACATGTCTGGTACAAATATGTGGCTTTGTTTCATTAATACAGTGTATACTTTTTTCTTTATTTACCCCGAAAGAAGGGAAGTGAAATGTGACAACATGCCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU485175 True 201 lncRNA 0.39 1 6972031 6972231

Neighbor

gene id symbol gene type direction distance location
CI01000304_06935639_06967113 DEPDC5 coding downstream 2977 6935528 ~ 6969054 (-)
CI01000304_06931421_06933921 YWHAG.S, 143G2, 143G1, YWHAH, YWHAG.L, YWHAG2, YWHAG, YWHAG1 coding downstream 37972 6930738 ~ 6934059 (-)
CI01000304_06914589_06924928 SLC5A1, SGLT1 coding downstream 46879 6913830 ~ 6925152 (-)
CI01000304_06881372_06883185 RNF208 coding downstream 88846 6881054 ~ 6883185 (-)
CI01000304_06867535_06870134 NA coding downstream 101897 6867117 ~ 6870134 (-)
CI01000304_07051182_07056250 NA coding upstream 78897 7051128 ~ 7056250 (-)
CI01000304_07065444_07081535 GNAZ coding upstream 92988 7065219 ~ 7081970 (-)
CI01000304_07183432_07198305 NT5C2L1 coding upstream 210391 7182622 ~ 7198305 (-)
CI01000304_07203008_07211715 NA coding upstream 230733 7202964 ~ 7211715 (-)
CI01000304_07212382_07216898 SKA1 coding upstream 239599 7211830 ~ 7216898 (-)
G422420 NA non-coding downstream 1161 6907385 ~ 6970870 (-)
G422373 NA non-coding downstream 284864 6686928 ~ 6687167 (-)
G422359 NA non-coding downstream 334583 6637226 ~ 6637448 (-)
G422357 NA non-coding downstream 335891 6635833 ~ 6636140 (-)
G422355 NA non-coding downstream 338245 6631651 ~ 6633786 (-)
G422436 NA non-coding upstream 9857 6982088 ~ 6983628 (-)
G422437 NA non-coding upstream 11464 6983695 ~ 6983943 (-)
G422439 NA non-coding upstream 14638 6986869 ~ 7028505 (-)
G422466 NA non-coding upstream 139924 7112155 ~ 7112374 (-)
G422468 NA non-coding upstream 147500 7119731 ~ 7120017 (-)
G422378 NA other downstream 188985 6744679 ~ 6783046 (-)
G422354 NA other downstream 340532 6631086 ~ 6631499 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other downstream 488536 6480743 ~ 6483986 (-)
CI01000304_04661808_04672936 PPWD1 other downstream 2299084 4661766 ~ 4672947 (-)
CI01000304_04263955_04264962 NA other downstream 2706830 4263846 ~ 4265201 (-)
G422810 NA other upstream 657928 7630159 ~ 7652703 (-)
G423386 NA other upstream 1889992 8862223 ~ 8865296 (-)
CI01000304_09566730_09575706 NA other upstream 2596125 9566730 ~ 9575706 (-)
CI01000304_09737662_09738777 NA other upstream 2764515 9736746 ~ 9738777 (-)
CI01000304_10160458_10161768 VAMP2 other upstream 3181215 10160458 ~ 10163762 (-)

Expression


Co-expression Network