G422466


Basic Information

Item Value
gene id G422466
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 7112155 ~ 7112374 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU485231
GGCCTTACAGTTTAGCCATTGAGGTGATGAGGTAATTGAAGGAGGCAGAAAGGTTTGAGGAAGGAGAACCTAAAATATATTTACTGCATTTACTTATTTAAATGCAATTTGGTATCAATGAATTCATATTCCTATTTCCTGTTTCCTTTAGTAAATTATTCTGAAGTGAAATCACGTTGCTGTTACCTGGCGTTGGAATGACATGTTTGACAGCTGTATA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU485231 True 220 lncRNA 0.35 1 7112155 7112374

Neighbor

gene id symbol gene type direction distance location
CI01000304_07065444_07081535 GNAZ coding downstream 30185 7065219 ~ 7081970 (-)
CI01000304_07051182_07056250 NA coding downstream 55905 7051128 ~ 7056250 (-)
CI01000304_06935639_06967113 DEPDC5 coding downstream 143101 6935528 ~ 6969054 (-)
CI01000304_06931421_06933921 YWHAG.S, 143G2, 143G1, YWHAH, YWHAG.L, YWHAG2, YWHAG, YWHAG1 coding downstream 178096 6930738 ~ 6934059 (-)
CI01000304_06914589_06924928 SLC5A1, SGLT1 coding downstream 187003 6913830 ~ 6925152 (-)
CI01000304_07183432_07198305 NT5C2L1 coding upstream 70248 7182622 ~ 7198305 (-)
CI01000304_07203008_07211715 NA coding upstream 90590 7202964 ~ 7211715 (-)
CI01000304_07212382_07216898 SKA1 coding upstream 99456 7211830 ~ 7216898 (-)
CI01000304_07218265_07232779 SMARCAD1B coding upstream 105846 7218220 ~ 7232779 (-)
CI01000304_07282197_07285838 NA coding upstream 169107 7281481 ~ 7285838 (-)
G422439 NA non-coding downstream 83650 6986869 ~ 7028505 (-)
G422437 NA non-coding downstream 128212 6983695 ~ 6983943 (-)
G422436 NA non-coding downstream 128527 6982088 ~ 6983628 (-)
G422429 NA non-coding downstream 139924 6972031 ~ 6972231 (-)
G422420 NA non-coding downstream 141285 6907385 ~ 6970870 (-)
G422468 NA non-coding upstream 7357 7119731 ~ 7120017 (-)
G422469 NA non-coding upstream 9877 7122251 ~ 7122511 (-)
G422473 NA non-coding upstream 15038 7127412 ~ 7128023 (-)
G422512 NA non-coding upstream 164625 7276999 ~ 7277246 (-)
G422442 NA non-coding upstream 209649 7322023 ~ 7325559 (-)
G422378 NA other downstream 329109 6744679 ~ 6783046 (-)
G422354 NA other downstream 480656 6631086 ~ 6631499 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other downstream 628660 6480743 ~ 6483986 (-)
CI01000304_04661808_04672936 PPWD1 other downstream 2439208 4661766 ~ 4672947 (-)
CI01000304_04263955_04264962 NA other downstream 2846954 4263846 ~ 4265201 (-)
G422810 NA other upstream 517785 7630159 ~ 7652703 (-)
G423386 NA other upstream 1749849 8862223 ~ 8865296 (-)
CI01000304_09566730_09575706 NA other upstream 2455982 9566730 ~ 9575706 (-)
CI01000304_09737662_09738777 NA other upstream 2624372 9736746 ~ 9738777 (-)
CI01000304_10160458_10161768 VAMP2 other upstream 3041072 10160458 ~ 10163762 (-)

Expression


Co-expression Network