G421369


Basic Information

Item Value
gene id G421369
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 7202960 ~ 7203215 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU483942
ACTTTTTATTGGTCAGCTTCTGATTTGACTACATGACTTATTCTGGCACTAAAGCTTGGTAGATATGGTGGTCTGGATATCGTTGATGTGTATTGAGCTCAGTTTGGACTGTAGTGAGTGTCTGCGTTTCTGGTGCATTCTCTTAAAGTCTTCTGTGATCTCCAGAACAGTTTTATTCTTTGTCTCAGGCACGTGGAACCACACAAAAACACCAGAGAGGAAGCAGAACACAAAAAATATGAGGAAGCAGAAATAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU483942 True 256 lncRNA 0.40 1 7202960 7203215

Neighbor

gene id symbol gene type direction distance location
CI01000304_07154005_07160649 SPPL3 coding upstream 41835 7154005 ~ 7161125 (+)
CI01000304_07024195_07048285 SLC5A1, SGLT1 coding upstream 154675 7024195 ~ 7048285 (+)
CI01000304_06986969_07013827 NA coding upstream 187126 6986828 ~ 7015834 (+)
CI01000304_06875225_06878962 NA coding upstream 323652 6873700 ~ 6879308 (+)
CI01000304_06864719_06866382 NA coding upstream 336515 6864719 ~ 6866445 (+)
CI01000304_07236677_07272874 KCNN2 coding downstream 32930 7236145 ~ 7272960 (+)
CI01000304_07288867_07299197 DRG1, DRG1.L coding downstream 85652 7288867 ~ 7299754 (+)
CI01000304_07314354_07323703 SLC20A1.L, SLC20A1.S, SLC20A1B, SLC20A1 coding downstream 110482 7313697 ~ 7324618 (+)
CI01000304_07334198_07342123 PIGO coding downstream 130847 7334062 ~ 7342298 (+)
CI01000304_07352697_07354032 NA coding downstream 149406 7352621 ~ 7354396 (+)
G421305 NA non-coding upstream 16773 7182644 ~ 7186187 (+)
G421311 NA non-coding upstream 25704 7175481 ~ 7177256 (+)
G421365 NA non-coding upstream 74228 7128493 ~ 7128732 (+)
G421362 NA non-coding upstream 76088 7126593 ~ 7126872 (+)
G421358 NA non-coding upstream 82919 7119810 ~ 7120041 (+)
G421383 NA non-coding downstream 73719 7276934 ~ 7277262 (+)
G421384 NA non-coding downstream 74415 7277630 ~ 7277888 (+)
G421387 NA non-coding downstream 77682 7280897 ~ 7283130 (+)
G421386 NA non-coding downstream 79991 7283206 ~ 7465770 (+)
G421399 NA non-coding downstream 164448 7367663 ~ 7368814 (+)
G421162 NA other upstream 959963 6241233 ~ 6242997 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other upstream 2026169 5173426 ~ 5176791 (+)
G420445 NA other upstream 2899128 4303336 ~ 4303832 (+)
G418981 NA other upstream 5109282 2092494 ~ 2093678 (+)
G418116 NA other upstream 6327711 872670 ~ 875249 (+)
G421435 NA other downstream 280926 7484141 ~ 7484688 (+)
CI01000304_07979388_07979919 TMEM230, TMEM230A other downstream 775413 7979078 ~ 7980735 (+)
CI01000304_08232073_08235598 NA other downstream 1028779 8231293 ~ 8235655 (+)
CI01000304_08671901_08672203 NA other downstream 1468555 8671770 ~ 8672555 (+)

Expression


Co-expression Network