G421399


Basic Information

Item Value
gene id G421399
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 7367663 ~ 7368814 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU483984
CTCATGACTGCCACTTTTCTTACTATGTTGCTTACCAGAAGTTTCTGTCTTACCCATGATACTCTCCAAAAAGGTCATGATGCCTATCCACAGCAGTGTATAAAAACAGATTTCTTGTTTTTTAAAGATGAAATTCCAACTTTATTTTGAAAATAAAACAAAAGATAATAACCATAACTTGATTAGATATTAATAATGAAAAATTTAATTCCAGTATTAGTTACCTGTGAACCTTAATGTAGAGTGGACACTTGTGAACCATTTATTCATGAGTTATGAACATTAATAACCTGTGAAAGTGAACCTTAATGTAAAGTGGAAACCTGTGAACCATTTATTAATGAGTTATAAACATTAATAACCTGTGAAAGTGAACCTTAATGTAAAGTGGAAACCTGTGAACCATTTATTCATGAGTTATAAACATTAATAACCTGTGAAAGTGAACCTTAATGTAAAGTGAACACATGTGAACCATTTATTAATGAGTTATAAACATTAATAACCTGTGAAAGTGAACCTTAATGTAAAAAGTGAACACGTGAATCATGTATTTATTAAAGCACACACAGAAGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU483984 True 576 lncRNA 0.30 3 7367663 7368814

Neighbor

gene id symbol gene type direction distance location
CI01000304_07352697_07354032 NA coding upstream 13267 7352621 ~ 7354396 (+)
CI01000304_07334198_07342123 PIGO coding upstream 25365 7334062 ~ 7342298 (+)
CI01000304_07314354_07323703 SLC20A1.L, SLC20A1.S, SLC20A1B, SLC20A1 coding upstream 43045 7313697 ~ 7324618 (+)
CI01000304_07288867_07299197 DRG1, DRG1.L coding upstream 67909 7288867 ~ 7299754 (+)
CI01000304_07236677_07272874 KCNN2 coding upstream 94703 7236145 ~ 7272960 (+)
CI01000304_07409324_07425656 PHF24 coding downstream 38906 7407720 ~ 7426027 (+)
CI01000304_07436662_07442126 PRKAB1A, PRKAB1 coding downstream 67848 7436662 ~ 7442692 (+)
CI01000304_07890347_07902088 PPP2R2AB, PPP2R2A coding downstream 521533 7890347 ~ 7902758 (+)
CI01000304_07909498_07914625 BNIP3LB coding downstream 540684 7909498 ~ 7915942 (+)
CI01000304_07927790_07957821 DPYSL2A, DPYSL2B, DPYSL2 coding downstream 558976 7927790 ~ 7958462 (+)
G421387 NA non-coding upstream 84533 7280897 ~ 7283130 (+)
G421384 NA non-coding upstream 89775 7277630 ~ 7277888 (+)
G421383 NA non-coding upstream 90401 7276934 ~ 7277262 (+)
G421369 NA non-coding upstream 164448 7202960 ~ 7203215 (+)
G421305 NA non-coding upstream 181476 7182644 ~ 7186187 (+)
G421434 NA non-coding downstream 114661 7483475 ~ 7483688 (+)
G421436 NA non-coding downstream 115939 7484753 ~ 7484961 (+)
G421440 NA non-coding downstream 122274 7491088 ~ 7491301 (+)
G421443 NA non-coding downstream 127216 7496030 ~ 7496396 (+)
G421446 NA non-coding downstream 130669 7499483 ~ 7500085 (+)
G421162 NA other upstream 1124666 6241233 ~ 6242997 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other upstream 2190872 5173426 ~ 5176791 (+)
G420445 NA other upstream 3063831 4303336 ~ 4303832 (+)
G418981 NA other upstream 5273985 2092494 ~ 2093678 (+)
G421435 NA other downstream 115327 7484141 ~ 7484688 (+)
CI01000304_07979388_07979919 TMEM230, TMEM230A other downstream 609814 7979078 ~ 7980735 (+)
CI01000304_08232073_08235598 NA other downstream 863180 8231293 ~ 8235655 (+)
CI01000304_08671901_08672203 NA other downstream 1302956 8671770 ~ 8672555 (+)
G423614 NA other downstream 1580222 8949036 ~ 8949422 (+)

Expression


Co-expression Network