G422725


Basic Information

Item Value
gene id G422725
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 7756566 ~ 7756767 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU485510
CTGAGTTACACCAGGGCTGCGTTCAGCCCCGACAAAACGTTTTTTAAACAGAAACGGTGCTGCGATGAACACCCTGTTCTGATGACGCAAGAGTTACAACTATGGCAGCTGAGAAGGCCATTCTTTGTGTTCTTTTTGGAGAATTTTCGGAGCCTGATGAAGTCGGTTTAATACTACAACATATGCTCGATGTTAAAGTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU485510 True 202 lncRNA 0.45 1 7756566 7756767

Neighbor

gene id symbol gene type direction distance location
CI01000304_07436662_07442126 PRKAB1A, PRKAB1 coding upstream 313874 7436662 ~ 7442692 (+)
CI01000304_07409324_07425656 PHF24 coding upstream 330539 7407720 ~ 7426027 (+)
CI01000304_07352697_07354032 NA coding upstream 402170 7352621 ~ 7354396 (+)
CI01000304_07334198_07342123 PIGO coding upstream 414268 7334062 ~ 7342298 (+)
CI01000304_07314354_07323703 SLC20A1.L, SLC20A1.S, SLC20A1B, SLC20A1 coding upstream 431948 7313697 ~ 7324618 (+)
CI01000304_07890347_07902088 PPP2R2AB, PPP2R2A coding downstream 133580 7890347 ~ 7902758 (+)
CI01000304_07909498_07914625 BNIP3LB coding downstream 152731 7909498 ~ 7915942 (+)
CI01000304_07927790_07957821 DPYSL2A, DPYSL2B, DPYSL2 coding downstream 171023 7927790 ~ 7958462 (+)
CI01000304_07979388_07979919 TMEM230, TMEM230A coding downstream 222311 7979078 ~ 7980735 (+)
CI01000304_07989774_08014921 IGSF9A coding downstream 232135 7988902 ~ 8015304 (+)
G422722 NA non-coding upstream 4983 7751240 ~ 7751583 (+)
G422719 NA non-coding upstream 13277 7743075 ~ 7743289 (+)
G422649 NA non-coding upstream 148886 7603453 ~ 7607680 (+)
G422639 NA non-coding upstream 163331 7593024 ~ 7593235 (+)
G422637 NA non-coding upstream 168126 7588063 ~ 7588440 (+)
G422733 NA non-coding downstream 1295 7758062 ~ 7908118 (+)
G422732 NA non-coding downstream 164946 7921713 ~ 7924050 (+)
G422778 NA non-coding downstream 212490 7969257 ~ 7969479 (+)
G422779 NA non-coding downstream 214370 7971137 ~ 7971363 (+)
G422780 NA non-coding downstream 215761 7972528 ~ 7972733 (+)
G421435 NA other upstream 271878 7484141 ~ 7484688 (+)
G421162 NA other upstream 1513569 6241233 ~ 6242997 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other upstream 2579775 5173426 ~ 5176791 (+)
G420445 NA other upstream 3452734 4303336 ~ 4303832 (+)
CI01000304_08232073_08235598 NA other downstream 475227 8231293 ~ 8235655 (+)
CI01000304_08671901_08672203 NA other downstream 915003 8671770 ~ 8672555 (+)
G423614 NA other downstream 1192269 8949036 ~ 8949422 (+)
CI01000304_09564068_09565679 HRH2B other downstream 1807838 9561005 ~ 9565778 (+)

Expression


Co-expression Network