XLOC_012675 (BX649610.2)


Basic Information

Item Value
gene id XLOC_012675
gene name BX649610.2
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 14989079 ~ 14996705 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00025333
GGTGACTTTGGAGGGCTCCACGTTGGGGTTCTCCCACTCCATCTGAGGGCAGTGCATGAAGTAGCAGAGCGTGTACAAGGCCTCGGGCTCCCAGTGGACCAAGCTGCTCTTCTGGGGCAACGGCGTCCCGTTACTGTGGTTCTTGATGCTCAGAGGCTGGAGCAGAGAAGGTGCCCTTCATCGGCAGACATGGAGAGTGGAGGAAGCAGAATGGTGTTTTACTGTGAAAACTGA

Function

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000095206

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00025333 True 234 processed_transcript 0.56 2 14989079 14996705
Loading

Neighbor

gene id symbol gene type direction distance location
XLOC_012674 uri1 coding upstream 283080 14693682 ~ 14705999 (+)
XLOC_012673 spata2l coding upstream 300641 14684115 ~ 14688438 (+)
XLOC_012672 vps9d1 coding upstream 320681 14633974 ~ 14668398 (+)
XLOC_012671 utp4 coding upstream 355771 14619544 ~ 14633308 (+)
XLOC_012670 wfdc1 coding upstream 371372 14595546 ~ 14617707 (+)
XLOC_012676 cry1b coding downstream 109813 15106518 ~ 15129696 (+)
XLOC_012677 zgc:153031 coding downstream 135407 15132112 ~ 15141119 (+)
XLOC_012678 si:ch73-62b13.1 coding downstream 178773 15175478 ~ 15188054 (+)
XLOC_012679 si:dkey-103i16.6 coding downstream 275288 15271993 ~ 15289997 (+)
XLOC_012680 NA coding downstream 436001 15432706 ~ 15440860 (+)
XLOC_012665 NA non-coding upstream 749620 14234369 ~ 14239459 (+)
XLOC_012664 BX649568.1 non-coding upstream 1040155 13948810 ~ 13948924 (+)
XLOC_012662 NA non-coding upstream 1473771 13494240 ~ 13515308 (+)
XLOC_012654 NA non-coding upstream 1829325 13133657 ~ 13159754 (+)
XLOC_012652 NA non-coding upstream 2047059 12941800 ~ 12942020 (+)
XLOC_012681 NA non-coding downstream 436759 15433464 ~ 15441472 (+)
XLOC_012682 NA non-coding downstream 449918 15446623 ~ 15449445 (+)
XLOC_012683 NA non-coding downstream 452800 15449505 ~ 15452652 (+)
XLOC_012684 NA non-coding downstream 457210 15453915 ~ 15456747 (+)

Expression

Expression of XLOC_012675(BX649610.2) in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: -0.5 to 0.5.
End of interactive chart.

Expression of XLOC_012675(BX649610.2) in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network