G422939


Basic Information

Item Value
gene id G422939
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 8002400 ~ 8004601 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU485737
GGGACACAGGAAGTCCATTAGTAGGCATGCAGGTGTAGTTCCCTGAATCCGCTGGAGTCAAACGCGATATAAGTAGTGTACCATCCACTATGATCTTAACACGAGACTTCAGAGACTCAATGTGGTAAATGTCTTCTCCTTGTCTTTGCCACACATAGGTCATGTTTGGTGGGTCAGCCTCAGCCTGGCACTTCAACTTGGCATCCTGGGACATGTTGAGAACAGTGTCGGTTGGAGGAATTACAATCACCGGAGGGCCAATGACTTTGACCTTTGTGATGTGAGTTACATTTCCTTCAGTGTTGGAGGCGTGACACTGATACTGGCCTGATGTTTCTCTGCTTACAGCATGGAAAGATACACTTCCATTCATGATCTTTACTTTGTTTTGAGGTTTTATTGGCCCTCCATCTTTAGACCAGGTTATTGTAGGCCGTGGATTTCCCTGGGCAGCACACTTCAGGGTTACTGATCTACCTACAAATACCTCAACGGCAGGAGGTGAGGTTTCCGTAAGCACAGGAGGTGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU485737 True 530 lncRNA 0.47 4 8002400 8004601

Neighbor

gene id symbol gene type direction distance location
CI01000304_07961608_07968820 NA coding downstream 33451 7961565 ~ 7968949 (-)
CI01000304_07612069_07709665 NA coding downstream 292735 7612069 ~ 7709665 (-)
CI01000304_07464639_07466430 NA coding downstream 535970 7464235 ~ 7466430 (-)
CI01000304_07325899_07328203 NA coding downstream 674197 7325648 ~ 7328203 (-)
CI01000304_07303509_07309222 STARD7 coding downstream 690689 7302824 ~ 7311711 (-)
CI01000304_08165245_08217042 NA coding upstream 160596 8165197 ~ 8217042 (-)
CI01000304_08218405_08218927 NA coding upstream 213033 8217634 ~ 8218927 (-)
CI01000304_08329095_08386362 GFRA2B, GFRA2 coding upstream 324494 8329095 ~ 8386362 (-)
CI01000304_08510508_08532975 NA coding upstream 505869 8510470 ~ 8533026 (-)
CI01000304_08567281_08570808 PBDC1 coding upstream 562593 8567194 ~ 8570808 (-)
G422935 NA non-coding downstream 20459 7981730 ~ 7981941 (-)
G422933 NA non-coding downstream 26009 7975943 ~ 7976391 (-)
G422931 NA non-coding downstream 31706 7970488 ~ 7970694 (-)
G422920 NA non-coding downstream 39671 7962370 ~ 7962729 (-)
G422918 NA non-coding downstream 72894 7928969 ~ 7929506 (-)
G422946 NA non-coding upstream 9441 8014042 ~ 8016684 (-)
G422951 NA non-coding upstream 24609 8029210 ~ 8029483 (-)
G422957 NA non-coding upstream 39922 8044523 ~ 8044813 (-)
G422959 NA non-coding upstream 46493 8051094 ~ 8051602 (-)
G422960 NA non-coding upstream 49009 8053610 ~ 8053832 (-)
G422810 NA other downstream 349697 7630159 ~ 7652703 (-)
G422378 NA other downstream 1219354 6744679 ~ 6783046 (-)
G422354 NA other downstream 1370901 6631086 ~ 6631499 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other downstream 1518905 6480743 ~ 6483986 (-)
CI01000304_04661808_04672936 PPWD1 other downstream 3329453 4661766 ~ 4672947 (-)
G423386 NA other upstream 857622 8862223 ~ 8865296 (-)
CI01000304_09566730_09575706 NA other upstream 1563755 9566730 ~ 9575706 (-)
CI01000304_09737662_09738777 NA other upstream 1732145 9736746 ~ 9738777 (-)
CI01000304_10160458_10161768 VAMP2 other upstream 2148845 10160458 ~ 10163762 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK other upstream 2185973 10190574 ~ 10192357 (-)

Expression


Co-expression Network