G422803


Basic Information

Item Value
gene id G422803
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 8039812 ~ 8040230 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU485590
AGTTACTTTTATAGGAAAAAAGGAAATAAAACAATATTGGTAGGTTTTGTCAGTTTTTAACACTGATATAATAATGGCCATTTTAAAGGGGTCATGACATGAGAAATCAAATTTGCCTTGATCTTTTGACATATAAGAGGTCTTTGTACCATTAAAACATCCTGCAAGTTTCATAACTTAAAATGTCATCATTATAAACAAAACATTTGTTTAATCAAGCTCCAAAAAATGGCTCGTTTTGATATTGTGGGATCTGTGATGTCACACGGGCAAATATATTTGCATATGACTCCCTCCAGAGCAAGACATCAACAAATAGTACATCACTGCACCATAGGCCCCACCCACTGGCATTCAGACTCTTAATGGCTGACATTTGCCTGCACTGAATGTGAATGTCGTGTCAAAAGCAAACTGAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU485590 True 419 lncRNA 0.36 1 8039812 8040230

Neighbor

gene id symbol gene type direction distance location
CI01000304_07989774_08014921 IGSF9A coding upstream 24508 7988902 ~ 8015304 (+)
CI01000304_07979388_07979919 TMEM230, TMEM230A coding upstream 59092 7979078 ~ 7980735 (+)
CI01000304_07927790_07957821 DPYSL2A, DPYSL2B, DPYSL2 coding upstream 81350 7927790 ~ 7958462 (+)
CI01000304_07909498_07914625 BNIP3LB coding upstream 123870 7909498 ~ 7915942 (+)
CI01000304_07890347_07902088 PPP2R2AB, PPP2R2A coding upstream 137054 7890347 ~ 7902758 (+)
CI01000304_08120416_08124549 LRRTM4L1 coding downstream 80186 8120416 ~ 8124597 (+)
CI01000304_08222591_08229908 NA coding downstream 182361 8222591 ~ 8230947 (+)
CI01000304_08232073_08235598 NA coding downstream 191063 8231293 ~ 8235655 (+)
CI01000304_08547909_08562342 XPO7 coding downstream 507679 8547909 ~ 8562604 (+)
CI01000304_08582404_08594691 DMTN coding downstream 542174 8582404 ~ 8594884 (+)
G422795 NA non-coding upstream 12689 8026858 ~ 8027123 (+)
G422783 NA non-coding upstream 64409 7975175 ~ 7975403 (+)
G422782 NA non-coding upstream 64764 7974837 ~ 7975048 (+)
G422781 NA non-coding upstream 65820 7973792 ~ 7973992 (+)
G422780 NA non-coding upstream 67079 7972528 ~ 7972733 (+)
G422966 NA non-coding downstream 24428 8064658 ~ 8065423 (+)
G422972 NA non-coding downstream 28832 8069062 ~ 8069399 (+)
G423041 NA non-coding downstream 107841 8148071 ~ 8148440 (+)
G423043 NA non-coding downstream 110572 8150802 ~ 8151170 (+)
G423046 NA non-coding downstream 112627 8152857 ~ 8153236 (+)
G421435 NA other upstream 555124 7484141 ~ 7484688 (+)
CI01000304_07352697_07354032 NA other upstream 685480 7352621 ~ 7354396 (+)
G421162 NA other upstream 1796815 6241233 ~ 6242997 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other upstream 2863021 5173426 ~ 5176791 (+)
CI01000304_08671901_08672203 NA other downstream 631540 8671770 ~ 8672555 (+)
G423614 NA other downstream 908806 8949036 ~ 8949422 (+)
CI01000304_09564068_09565679 HRH2B other downstream 1524375 9561005 ~ 9565778 (+)
G424246 NA other downstream 2080169 10116343 ~ 10127322 (+)

Expression


Co-expression Network