G423375


Basic Information

Item Value
gene id G423375
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 8236882 ~ 8237130 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU486220
AAACCACAGGGCAAACAATCCAGATAGCAACAGAGTCCAAGACAAGGGCAGAAGATCAAGACCATGACACAGAAACCAGAAGTAGAGCTCAGAAATGCAGTGAGACATTAACAAGACTTTGCAATGAGTGAGTGAAAACACAGAGCTTATAAAGGCAAACACAAACAAGTTAATCACACACAGGTAGAATTAATCAGACCATAATGAGCCAAGGAAATGGGTTATGGGAAATGTAGTTCATGATGGGAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU486220 True 249 lncRNA 0.41 1 8236882 8237130

Neighbor

gene id symbol gene type direction distance location
CI01000304_08218405_08218927 NA coding downstream 17955 8217634 ~ 8218927 (-)
CI01000304_08165245_08217042 NA coding downstream 19840 8165197 ~ 8217042 (-)
CI01000304_07961608_07968820 NA coding downstream 267933 7961565 ~ 7968949 (-)
CI01000304_07612069_07709665 NA coding downstream 527217 7612069 ~ 7709665 (-)
CI01000304_07464639_07466430 NA coding downstream 770452 7464235 ~ 7466430 (-)
CI01000304_08329095_08386362 GFRA2B, GFRA2 coding upstream 91965 8329095 ~ 8386362 (-)
CI01000304_08510508_08532975 NA coding upstream 273340 8510470 ~ 8533026 (-)
CI01000304_08567281_08570808 PBDC1 coding upstream 330064 8567194 ~ 8570808 (-)
CI01000304_08605819_08615439 HTR7B coding upstream 367745 8604875 ~ 8617967 (-)
CI01000304_08680653_08681838 NA coding upstream 443001 8680131 ~ 8682389 (-)
G423369 NA non-coding downstream 1591 8231994 ~ 8235291 (-)
G423337 NA non-coding downstream 16708 8219608 ~ 8220174 (-)
G423368 NA non-coding downstream 44875 8190502 ~ 8192007 (-)
G423367 NA non-coding downstream 79185 8157485 ~ 8157697 (-)
G423356 NA non-coding downstream 88413 8148071 ~ 8148469 (-)
G423379 NA non-coding upstream 4730 8241860 ~ 8242079 (-)
G423448 NA non-coding upstream 67054 8304184 ~ 8304715 (-)
G423454 NA non-coding upstream 80771 8317901 ~ 8322796 (-)
G423472 NA non-coding upstream 152689 8389819 ~ 8390034 (-)
G423474 NA non-coding upstream 153406 8390536 ~ 8390762 (-)
G422810 NA other downstream 584179 7630159 ~ 7652703 (-)
G422378 NA other downstream 1453836 6744679 ~ 6783046 (-)
G422354 NA other downstream 1605383 6631086 ~ 6631499 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other downstream 1753387 6480743 ~ 6483986 (-)
CI01000304_04661808_04672936 PPWD1 other downstream 3563935 4661766 ~ 4672947 (-)
G423386 NA other upstream 625093 8862223 ~ 8865296 (-)
CI01000304_09566730_09575706 NA other upstream 1331226 9566730 ~ 9575706 (-)
CI01000304_09737662_09738777 NA other upstream 1499616 9736746 ~ 9738777 (-)
CI01000304_10160458_10161768 VAMP2 other upstream 1916316 10160458 ~ 10163762 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK other upstream 1953444 10190574 ~ 10192357 (-)

Expression


Co-expression Network