G423197



Basic Information


Item Value
gene id G423197
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 8470284 ~ 8470504 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU486012
CCCTTTTAGACCATGCGCCAGGTGCACCGACCATTTTTCCCATTGTTAAACTAGCAAAAGTGGATTCGGACACGCCCTAAGTGCACTTGTGCCGTGCACTTTAGACCATGTGCTTAGATCGTTAAAATAGGGCCCAATAAGTCTATAATTCCACCCACTTTGAAGCGGTACTACAATAAAATGGAAAAGCAAACCGAGCCAAAGTAAAGCAAGCCGAGCCG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU486012 True 221 lncRNA 0.46 1 8470284 8470504
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000304_08232073_08235598 NA coding upstream 234629 8231293 ~ 8235655 (+)
CI01000304_08222591_08229908 NA coding upstream 239337 8222591 ~ 8230947 (+)
CI01000304_08120416_08124549 LRRTM4L1 coding upstream 345687 8120416 ~ 8124597 (+)
CI01000304_07989774_08014921 IGSF9A coding upstream 454980 7988902 ~ 8015304 (+)
CI01000304_07979388_07979919 TMEM230, TMEM230A coding upstream 489564 7979078 ~ 7980735 (+)
CI01000304_08547909_08562342 XPO7 coding downstream 77405 8547909 ~ 8562604 (+)
CI01000304_08582404_08594691 DMTN coding downstream 111900 8582404 ~ 8594884 (+)
CI01000304_08624038_08653167 PPP3CCA, PPP3CCB, PPP3CC, PP2BC coding downstream 153534 8624038 ~ 8653550 (+)
CI01000304_08671901_08672203 NA coding downstream 201300 8671770 ~ 8672555 (+)
CI01000304_08741397_08752689 NA coding downstream 270893 8741397 ~ 8752689 (+)
G423179 NA non-coding upstream 33327 8436749 ~ 8436957 (+)
G423105 NA non-coding upstream 145321 8324737 ~ 8324963 (+)
G423101 NA non-coding upstream 157572 8312414 ~ 8312712 (+)
G423099 NA non-coding upstream 159206 8310872 ~ 8311078 (+)
G423093 NA non-coding upstream 177163 8292887 ~ 8293121 (+)
G423202 NA non-coding downstream 6333 8476837 ~ 8477075 (+)
G423234 NA non-coding downstream 13398 8483902 ~ 8536866 (+)
G423242 NA non-coding downstream 43402 8513906 ~ 8514257 (+)
G423243 NA non-coding downstream 51046 8521550 ~ 8522567 (+)
G423252 NA non-coding downstream 71926 8542430 ~ 8542677 (+)
G421435 NA other upstream 985596 7484141 ~ 7484688 (+)
CI01000304_07352697_07354032 NA other upstream 1115952 7352621 ~ 7354396 (+)
G421162 NA other upstream 2227287 6241233 ~ 6242997 (+)
G423614 NA other downstream 478532 8949036 ~ 8949422 (+)
CI01000304_09564068_09565679 HRH2B other downstream 1094101 9561005 ~ 9565778 (+)
G424246 NA other downstream 1649895 10116343 ~ 10127322 (+)
G424251 NA other downstream 1718318 10188822 ~ 10189404 (+)

Expression


G423197 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G423197 Expression in each Bioproject

Bar chart with 21 bars.
G423197 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network