G424200


Basic Information

Item Value
gene id G424200
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 9671187 ~ 9671733 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU487125
AAACACACATGCAGACATTCAAGTTTCACACTAAGTAGAACAAGATTGATACATGTAAAAAATAATAAAAAAGCATACACTCAATTAAAAATCATCAAAATGACACCGAAACTAATATCTTCTAATTTTTCTCATCTACCTGTCCTTCTTTCTCACAAACCAATAACTCATTAATGAAAGTATTTCTAGTTGCTTAATGTGTAAAATTAGATCCTACCTGTCCTGTAGGTGACCTGTTTGGTGTGCATAGAAAAGGTCCCCAGTACTACACCCATCTTCATTAGAGTTCTTCACTTTTTCACTTTCCTCACTTCAGATCTTGGTTTGAAAAAAAATCACTATTCCCTGTTTTTGTATTTTATCTCCTGATCTCTTTTGCTCTCAGAGTTGCTGGTTACTAGCTCTCGCTGTCTCTGACTTTCCTCCGCGTTCTGTCTGTCTATCATGTGGACTCTGAAGGCTGCTCATCATTTCCTGAGCTTTTATGGGGCTGAGAGAGAGGAGGGGGATGAGGAGAGGATGAGAGATGGTGAGTGGTTCATATAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU487125 True 547 lncRNA 0.38 1 9671187 9671733

Neighbor

gene id symbol gene type direction distance location
CI01000304_09622805_09640521 NA coding downstream 30647 9622376 ~ 9640540 (-)
CI01000304_09609674_09619712 NA coding downstream 51157 9609510 ~ 9620030 (-)
CI01000304_09577749_09578512 NA coding downstream 92675 9576119 ~ 9578512 (-)
CI01000304_09566730_09575706 NA coding downstream 95481 9566730 ~ 9575706 (-)
CI01000304_09508090_09519201 NA coding downstream 151854 9507297 ~ 9519333 (-)
CI01000304_09699524_09703985 TLX3B coding upstream 27635 9699368 ~ 9706659 (-)
CI01000304_09720695_09725068 UGT5G2 coding upstream 48543 9720276 ~ 9725068 (-)
CI01000304_09726631_09727403 NA coding upstream 54214 9725947 ~ 9730308 (-)
CI01000304_09737662_09738777 NA coding upstream 65493 9736746 ~ 9738777 (-)
CI01000304_09751291_09754997 CLDN7B, CLDX, CLDN7 coding upstream 79188 9750921 ~ 9755245 (-)
G424199 NA non-coding downstream 2210 9668750 ~ 9668977 (-)
G424197 NA non-coding downstream 10170 9660595 ~ 9661017 (-)
G424196 NA non-coding downstream 10862 9659583 ~ 9660325 (-)
G424170 NA non-coding downstream 11900 9658330 ~ 9659287 (-)
G424190 NA non-coding downstream 21310 9649661 ~ 9649877 (-)
G424201 NA non-coding upstream 11 9671744 ~ 9672047 (-)
G424202 NA non-coding upstream 3140 9674873 ~ 9675087 (-)
G424203 NA non-coding upstream 4396 9676129 ~ 9691240 (-)
G424169 NA non-coding upstream 22792 9694525 ~ 9695379 (-)
G424159 NA non-coding upstream 24000 9695733 ~ 9697323 (-)
G423386 NA other downstream 805891 8862223 ~ 8865296 (-)
G422810 NA other downstream 2018484 7630159 ~ 7652703 (-)
G422378 NA other downstream 2888141 6744679 ~ 6783046 (-)
G422354 NA other downstream 3039688 6631086 ~ 6631499 (-)
CI01000304_10160458_10161768 VAMP2 other upstream 481713 10160458 ~ 10163762 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK other upstream 518841 10190574 ~ 10192357 (-)
G424808 NA other upstream 772622 10444355 ~ 10542665 (-)
CI01000304_11338304_11348212 ILK other upstream 1675287 11338019 ~ 11348212 (-)

Expression


Co-expression Network