G424239


Basic Information

Item Value
gene id G424239
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 9840107 ~ 9840527 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU487170
TGGGCCCATTTAGTAATGTCATTGACACAATCATGCCGATGAGTGATGCAGTGTCGTCTGAGGGCCCGAAGACCACGGGCATCCAATAAAGGTCTTTAGCCTTGTCTCTTACGCACAGAGATTTCTCCAGTTTCTCTGAATCTTTTGATGATGTTATGCACTGTAGATGATGAGATTTGCAAAGCCTTTGTAATTTGACATTGAGGAAAATTGTTTTTAAAGTATTCCACAATCTTTTAAGCACTCTTTCACAGCTCTGCTCATCTTTACTTCTGAGAGACTCTGCCTCTCTAAGACATCCCTTTTATAGCTAATCATGTTACAGACCTGATATCAGTTAACTTATTTAGTTGCTAGATGTTCTCCCAGCTGAATCTTTTCAAAATGTCTTGCTTTTTCAGCCATTTGTTGCCCCCGTGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU487170 True 421 lncRNA 0.41 1 9840107 9840527

Neighbor

gene id symbol gene type direction distance location
CI01000304_09765626_09814386 FGF11B, FGF11, FGF11A coding downstream 25721 9765626 ~ 9814386 (-)
CI01000304_09751291_09754997 CLDN7B, CLDX, CLDN7 coding downstream 84862 9750921 ~ 9755245 (-)
CI01000304_09737662_09738777 NA coding downstream 101330 9736746 ~ 9738777 (-)
CI01000304_09726631_09727403 NA coding downstream 109799 9725947 ~ 9730308 (-)
CI01000304_09720695_09725068 UGT5G2 coding downstream 115039 9720276 ~ 9725068 (-)
CI01000304_09944778_09945833 NA coding upstream 104096 9944623 ~ 9945833 (-)
CI01000304_09949821_09951564 NA coding upstream 108638 9949165 ~ 9953257 (-)
CI01000304_09955649_09957311 NA coding upstream 115027 9955554 ~ 9959307 (-)
CI01000304_10119297_10119833 NA coding upstream 278363 10118890 ~ 10119833 (-)
CI01000304_10123588_10128249 PCOLCE, PCOLCEA coding upstream 282880 10123407 ~ 10128249 (-)
G424218 NA non-coding downstream 95489 9744205 ~ 9744618 (-)
G424217 NA non-coding downstream 96089 9743568 ~ 9744018 (-)
G424159 NA non-coding downstream 142784 9695733 ~ 9697323 (-)
G424169 NA non-coding downstream 144728 9694525 ~ 9695379 (-)
G424203 NA non-coding downstream 148867 9676129 ~ 9691240 (-)
G424418 NA non-coding upstream 136732 9977259 ~ 9977486 (-)
G424448 NA non-coding upstream 193067 10033594 ~ 10036068 (-)
G424482 NA non-coding upstream 221738 10062265 ~ 10062752 (-)
G424474 NA non-coding upstream 241871 10082398 ~ 10090227 (-)
G424496 NA non-coding upstream 319121 10159648 ~ 10160361 (-)
CI01000304_09566730_09575706 NA other downstream 271073 9566730 ~ 9575706 (-)
G423386 NA other downstream 974811 8862223 ~ 8865296 (-)
G422810 NA other downstream 2187404 7630159 ~ 7652703 (-)
G422378 NA other downstream 3057061 6744679 ~ 6783046 (-)
CI01000304_10160458_10161768 VAMP2 other upstream 312919 10160458 ~ 10163762 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK other upstream 350047 10190574 ~ 10192357 (-)
G424808 NA other upstream 603828 10444355 ~ 10542665 (-)
CI01000304_11338304_11348212 ILK other upstream 1506493 11338019 ~ 11348212 (-)
G425580 NA other upstream 2028150 11868677 ~ 11872906 (-)

Expression


Co-expression Network