G424797


Basic Information

Item Value
gene id G424797
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 10262071 ~ 10262340 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU487796
CTTGGGTTGGTTTTTGACTTGTGCAAAAGAGAGTTAATGGGAGATGGAAACGCATTTGCCGAATAAATTATGACTTAGCGAACATTAAACCCACGTGACTAATCGGCTGATTCCGCTGATGGTGTTTTATTTACTGTTGGTTACTAGGTTACCAATTCCACCATCATCTGCTCGAAGAACTTGATGGAAACGCACCTAATTCGCATTTGTTTTTTTGTTTGAACTTTGAAAATATTCACTTCACGCTTGGATGGAAACCCAGATAGTGTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU487796 True 270 lncRNA 0.40 1 10262071 10262340

Neighbor

gene id symbol gene type direction distance location
CI01000304_10220812_10226103 NA coding downstream 35968 10219589 ~ 10226103 (-)
CI01000304_10209150_10210418 NA coding downstream 51180 10208635 ~ 10210891 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK coding downstream 69714 10190574 ~ 10192357 (-)
CI01000304_10187728_10188909 NA coding downstream 73162 10187271 ~ 10188909 (-)
CI01000304_10167646_10169639 NA coding downstream 92432 10166187 ~ 10169639 (-)
CI01000304_10284509_10291314 NLE1, NLE1.S coding upstream 22169 10284509 ~ 10291314 (-)
CI01000304_10350748_10388571 CADM2A coding upstream 87529 10349869 ~ 10388602 (-)
CI01000304_10812673_10812980 NA coding upstream 550193 10812533 ~ 10815238 (-)
CI01000304_11065581_11077156 NA coding upstream 802899 11065239 ~ 11077156 (-)
CI01000304_11083948_11091592 PITPNAB, PITPNA coding upstream 821498 11083838 ~ 11091592 (-)
G424535 NA non-coding downstream 9609 10252221 ~ 10252462 (-)
G424504 NA non-coding downstream 87924 10173599 ~ 10174147 (-)
G424496 NA non-coding downstream 101710 10159648 ~ 10160361 (-)
G424474 NA non-coding downstream 171844 10082398 ~ 10090227 (-)
G424482 NA non-coding downstream 199319 10062265 ~ 10062752 (-)
G424823 NA non-coding upstream 9583 10271923 ~ 10272411 (-)
G424829 NA non-coding upstream 54962 10317302 ~ 10317531 (-)
G424830 NA non-coding upstream 55271 10317611 ~ 10318093 (-)
G424831 NA non-coding upstream 56390 10318730 ~ 10319031 (-)
G424817 NA non-coding upstream 170840 10433180 ~ 10491120 (-)
CI01000304_10160458_10161768 VAMP2 other downstream 97741 10160458 ~ 10163762 (-)
CI01000304_09737662_09738777 NA other downstream 522600 9736746 ~ 9738777 (-)
CI01000304_09566730_09575706 NA other downstream 693037 9566730 ~ 9575706 (-)
G423386 NA other downstream 1396775 8862223 ~ 8865296 (-)
G424808 NA other upstream 182015 10444355 ~ 10542665 (-)
CI01000304_11338304_11348212 ILK other upstream 1084680 11338019 ~ 11348212 (-)
G425580 NA other upstream 1606337 11868677 ~ 11872906 (-)
G426106 NA other upstream 2074361 12336701 ~ 12340228 (-)
CI01000304_12559311_12559998 NA other upstream 2296514 12558854 ~ 12560135 (-)

Expression


Co-expression Network