G424830


Basic Information

Item Value
gene id G424830
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 10317611 ~ 10318093 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU487833
TCAGTAAAGACTTCAATTTTTTTATTCCTTTTGTTTAGACAAGGAAAAGCATGGCATATTTCCCCAAATGTGTTTTTTAACAGACTATTCACTAAAAAGTGATGAAAAGAGGCATTGAGAGAGAGAAATAGTTGGATATCTTACAGCTTGAAGGTTGTTTTTGAGCCAGTCATATATCAGCAGAATGAGTTGGCCTGTGACAGAGCTCGGAGCACCTTGGATCTCGACCCAGCGATGGGCGTCCAGATTTCCTGGGCCGCTCGTACACTAAGCATTCCAATAGGATGAGAAATGTTGTTTGCTTTAGGCCACAGTATATCACTCCACGGCCTTGCCACTTGTTGACAACTGTGACCTTGTTAGAATCTATAAGTGAGACATCCACTTTCAAGTCGTAAAAACTGCAAAGCCTTATTACATTTTTCCCCACTAGTTCTACCCTTGAAGAGAGACATAAGATTTTTTTATATATATATATATATA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU487833 True 483 lncRNA 0.39 1 10317611 10318093

Neighbor

gene id symbol gene type direction distance location
CI01000304_10284509_10291314 NLE1, NLE1.S coding downstream 26297 10284509 ~ 10291314 (-)
CI01000304_10220812_10226103 NA coding downstream 91508 10219589 ~ 10226103 (-)
CI01000304_10209150_10210418 NA coding downstream 106720 10208635 ~ 10210891 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK coding downstream 125254 10190574 ~ 10192357 (-)
CI01000304_10187728_10188909 NA coding downstream 128702 10187271 ~ 10188909 (-)
CI01000304_10350748_10388571 CADM2A coding upstream 31776 10349869 ~ 10388602 (-)
CI01000304_10812673_10812980 NA coding upstream 494440 10812533 ~ 10815238 (-)
CI01000304_11065581_11077156 NA coding upstream 747146 11065239 ~ 11077156 (-)
CI01000304_11083948_11091592 PITPNAB, PITPNA coding upstream 765745 11083838 ~ 11091592 (-)
CI01000304_11110559_11121354 SLC43A2B coding upstream 792370 11110463 ~ 11122171 (-)
G424829 NA non-coding downstream 80 10317302 ~ 10317531 (-)
G424823 NA non-coding downstream 45200 10271923 ~ 10272411 (-)
G424797 NA non-coding downstream 55271 10262071 ~ 10262340 (-)
G424535 NA non-coding downstream 65149 10252221 ~ 10252462 (-)
G424504 NA non-coding downstream 143464 10173599 ~ 10174147 (-)
G424831 NA non-coding upstream 637 10318730 ~ 10319031 (-)
G424817 NA non-coding upstream 115087 10433180 ~ 10491120 (-)
G424813 NA non-coding upstream 134368 10452461 ~ 10564732 (-)
G424810 NA non-coding upstream 229587 10547680 ~ 10561382 (-)
G424806 NA non-coding upstream 247535 10565628 ~ 10580012 (-)
CI01000304_10160458_10161768 VAMP2 other downstream 153281 10160458 ~ 10163762 (-)
CI01000304_09737662_09738777 NA other downstream 578140 9736746 ~ 9738777 (-)
CI01000304_09566730_09575706 NA other downstream 748577 9566730 ~ 9575706 (-)
G423386 NA other downstream 1452315 8862223 ~ 8865296 (-)
G424808 NA other upstream 126262 10444355 ~ 10542665 (-)
CI01000304_11338304_11348212 ILK other upstream 1028927 11338019 ~ 11348212 (-)
G425580 NA other upstream 1550584 11868677 ~ 11872906 (-)
G426106 NA other upstream 2018608 12336701 ~ 12340228 (-)
CI01000304_12559311_12559998 NA other upstream 2240761 12558854 ~ 12560135 (-)

Expression


Co-expression Network