G425058


Basic Information

Item Value
gene id G425058
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 11072329 ~ 11072732 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU488088
TGTGGTCAAGCACGTTTGGTGTGTTGTACATATCGAAATCTTGCGTGTCCAGTATATATTCAAACTCATCCATGCGTTGCAGGGCGTAGTTCATATGAGCCGCCAGATGACAGTTCAGAAAACACAGCATGTGACCATAAAATGAGAAACGCACAGAAACACCACCCTTATTTCCCTGCAAGAATCAATAATACTACATTAGTCCAGCTACACATTGTTATACTCTCACATATTCGTTACCGTTAAAAGTACAGGTTTAGGTGTTTTGTTTTGTTTTTTGTTTTTTCCCCCAAAATTTTACACAAAAGATTACAGATCAGATTTATATACCACCTTTCAACATTTTATTTTTTTTAATTAATACTTTTATTCAGCAAGGATGCATTAAATTAATCCAAAGTGAC

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU488088 True 404 lncRNA 0.35 1 11072329 11072732

Neighbor

gene id symbol gene type direction distance location
CI01000304_11011297_11032025 NA coding upstream 40243 11009578 ~ 11032086 (+)
CI01000304_10927170_10992558 NA coding upstream 79771 10927170 ~ 10992558 (+)
CI01000304_10586097_10589143 NA coding upstream 482721 10585348 ~ 10589608 (+)
CI01000304_10577811_10579298 NA coding upstream 491792 10577701 ~ 10580537 (+)
CI01000304_10555326_10571933 NA coding upstream 500165 10555216 ~ 10572164 (+)
CI01000304_11140964_11155540 PAXBP1 coding downstream 68232 11140964 ~ 11155892 (+)
CI01000304_11170412_11182604 SLC7A1 coding downstream 97134 11169866 ~ 11182641 (+)
CI01000304_11215537_11253484 MTUS2A coding downstream 142205 11214937 ~ 11253581 (+)
CI01000304_11264394_11268134 SLC46A3 coding downstream 191662 11264394 ~ 11268134 (+)
CI01000304_11288992_11297645 VPS36 coding downstream 216260 11288992 ~ 11298149 (+)
G425052 NA non-coding upstream 173 11066492 ~ 11072156 (+)
G424936 NA non-coding upstream 6772 11064518 ~ 11065557 (+)
G424794 NA non-coding upstream 221754 10850310 ~ 10850575 (+)
G424790 NA non-coding upstream 234854 10837185 ~ 10837475 (+)
G424547 NA non-coding upstream 494076 10532246 ~ 10543770 (+)
G425027 NA non-coding downstream 43388 11116120 ~ 11122174 (+)
G425073 NA non-coding downstream 64657 11137389 ~ 11137708 (+)
G425048 NA non-coding downstream 119453 11192185 ~ 11209025 (+)
G425081 NA non-coding downstream 207795 11280527 ~ 11280867 (+)
G425044 NA non-coding downstream 208231 11280963 ~ 11281207 (+)
G424251 NA other upstream 879434 10188822 ~ 10189404 (+)
G424246 NA other upstream 945007 10116343 ~ 10127322 (+)
CI01000304_09564068_09565679 HRH2B other upstream 1506756 9561005 ~ 9565778 (+)
G423614 NA other upstream 2122907 8949036 ~ 8949422 (+)
G425718 NA other downstream 1355973 12436554 ~ 12436605 (+)
CI01000304_13578347_13595075 NA other downstream 2483719 13578049 ~ 13595097 (+)
G426312 NA other downstream 3257316 14330048 ~ 14330886 (+)
G426828 NA other downstream 3876158 14948890 ~ 14950592 (+)
G427860 NA other downstream 4812722 15885454 ~ 15889591 (+)

Expression


Co-expression Network