G425269


Basic Information

Item Value
gene id G425269
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 11429617 ~ 11430150 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU488328
TGACCACAGAGAGTCAGGACCTCGGTTTAATGTCTCATCCGAAGGATGGATATACTGTAGAATAACTGTAGCTAGCAAAGAAAAAAACAAATCATTTCTAGAAATGACTGGAACTTGCAATCAAAAATAAATAAAACAAGATTGCAACCCTGCAGGGAACTAGAAAAAAATACGATTTGTTAACAAAATAAATTCAAGAGAGAAACCAAAAAATAAGGCTTGGGAGAACTAGAGAAAAAAATAAAGACTAGAACTAGACTAGAGTAAAAACTAGAATTTATCAATAAGGAAATAAATCAATACAAGACTAGACTGGCAGGGAAAAAAACTAGTGATGCACTCAAAAAAATGATTTTTTGATGCTGTTCACTTTATTTAAACAACTTATTTTGATTCAACACAATTGTATTAGGTTTCTGGTACAAATTTAATTGCTTCATGTTAAATTGACTTGAAACGATTACTTTTTGACTTAACTTGATGTTTTCATATTAAAATAACATGTTTCAATCAAGTAAACTCAACCAGGACTCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU488328 True 534 lncRNA 0.30 1 11429617 11430150

Neighbor

gene id symbol gene type direction distance location
CI01000304_11368905_11374145 NA coding downstream 55472 11368859 ~ 11374145 (-)
CI01000304_11359135_11362408 NA coding downstream 67209 11358917 ~ 11362408 (-)
CI01000304_11338304_11348212 ILK coding downstream 81405 11338019 ~ 11348212 (-)
CI01000304_11330383_11335607 SMPD1 coding downstream 93497 11329642 ~ 11336120 (-)
CI01000304_11304660_11306789 NA coding downstream 122746 11304560 ~ 11306871 (-)
CI01000304_11445002_11447156 NA coding upstream 13581 11443731 ~ 11447156 (-)
CI01000304_11479874_11503083 MTNR1B, MTNR1BB coding upstream 49520 11479670 ~ 11503494 (-)
CI01000304_11526057_11569114 NA coding upstream 95849 11525999 ~ 11569114 (-)
CI01000304_11575414_11578638 NA coding upstream 145178 11575328 ~ 11578638 (-)
CI01000304_11638983_11647850 TMEM135 coding upstream 208263 11638413 ~ 11649085 (-)
G425204 NA non-coding downstream 148413 11280976 ~ 11281204 (-)
G425230 NA non-coding downstream 159129 11269185 ~ 11270488 (-)
G425229 NA non-coding downstream 161168 11268197 ~ 11268449 (-)
G425228 NA non-coding downstream 162520 11266326 ~ 11267097 (-)
G425187 NA non-coding downstream 179406 11245182 ~ 11250211 (-)
G425479 NA non-coding upstream 17477 11447627 ~ 11447954 (-)
G425517 NA non-coding upstream 149081 11579231 ~ 11579432 (-)
G425533 NA non-coding upstream 168739 11598889 ~ 11599266 (-)
G425559 NA non-coding upstream 242212 11672362 ~ 11672698 (-)
G425549 NA non-coding upstream 266444 11696594 ~ 11698398 (-)
G424808 NA other downstream 886952 10444355 ~ 10542665 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK other downstream 1236722 10190574 ~ 10192357 (-)
CI01000304_10160458_10161768 VAMP2 other downstream 1265287 10160458 ~ 10163762 (-)
CI01000304_09737662_09738777 NA other downstream 1690146 9736746 ~ 9738777 (-)
G425580 NA other upstream 438527 11868677 ~ 11872906 (-)
G426106 NA other upstream 906551 12336701 ~ 12340228 (-)
CI01000304_12559311_12559998 NA other upstream 1128704 12558854 ~ 12560135 (-)
G426147 NA other upstream 1265848 12719497 ~ 12805926 (-)
G427057 NA other upstream 2077491 13507641 ~ 13507922 (-)

Expression


Co-expression Network