G425354


Basic Information

Item Value
gene id G425354
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 11621106 ~ 11621440 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU488422
GAACGATTCATCCGCTCAAAAACTATTTCGTTCATGTATCACCACTGTTTTTTGTCTCATGAGTGTTTATATGGTTATCAATTGTCTACGAAAACGAACACTTTGCTTTCCATAACATTTAGTTGTACATTTCTTCTAGTAAATATGAGATAAAATAATATTAAATAATAAAAAAAGTGTAACAATTTGCATATAGCTCTTTTTAAGGCGATGCTGAGGAAATCCTCATCTTCTAAACCATAATAATGATGGAACATTTTAAGTCCTGGCAACATTTAAAGGATTAGTTCACTTTCAAATGAAAATTACCCCAAGCTTTACTTACCCTCAAGCCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU488422 True 335 lncRNA 0.31 1 11621106 11621440

Neighbor

gene id symbol gene type direction distance location
CI01000304_11613446_11620345 RAB38 coding upstream 543 11613446 ~ 11620563 (+)
CI01000304_11582257_11610398 GRM5, GRM5A coding upstream 10495 11581808 ~ 11610611 (+)
CI01000304_11570457_11574856 CHORDC1 coding upstream 45816 11570457 ~ 11575290 (+)
CI01000304_11449463_11453214 NA coding upstream 167791 11448966 ~ 11453315 (+)
CI01000304_11323923_11325889 NA coding upstream 295201 11322230 ~ 11325905 (+)
CI01000304_11676155_11681977 MAP3K7CL coding downstream 54715 11676155 ~ 11683131 (+)
CI01000304_11685224_11691071 NA coding downstream 63784 11685224 ~ 11691071 (+)
CI01000304_11812792_11817948 NA coding downstream 191074 11812514 ~ 11818413 (+)
CI01000304_11866424_11868022 UGT5D1 coding downstream 244660 11866100 ~ 11868083 (+)
CI01000304_11993486_12061098 FREM2, FREM2A coding downstream 372046 11993486 ~ 12062218 (+)
G425338 NA non-coding upstream 51235 11565954 ~ 11569871 (+)
G425317 NA non-coding upstream 94207 11514772 ~ 11526899 (+)
G425316 NA non-coding upstream 108405 11512489 ~ 11512701 (+)
G425294 NA non-coding upstream 151101 11469766 ~ 11470005 (+)
G425277 NA non-coding upstream 174733 11435670 ~ 11446373 (+)
G425356 NA non-coding downstream 1365 11622805 ~ 11623009 (+)
G425358 NA non-coding downstream 2780 11624220 ~ 11624518 (+)
G425359 NA non-coding downstream 3151 11624591 ~ 11624842 (+)
G425361 NA non-coding downstream 4081 11625521 ~ 11625765 (+)
G425362 NA non-coding downstream 4644 11626084 ~ 11626301 (+)
CI01000304_10555326_10571933 NA other upstream 1065402 10555216 ~ 10572164 (+)
G424251 NA other upstream 1428211 10188822 ~ 10189404 (+)
G424246 NA other upstream 1493784 10116343 ~ 10127322 (+)
CI01000304_09564068_09565679 HRH2B other upstream 2055533 9561005 ~ 9565778 (+)
G423614 NA other upstream 2671684 8949036 ~ 8949422 (+)
G425718 NA other downstream 807265 12436554 ~ 12436605 (+)
CI01000304_13578347_13595075 NA other downstream 1935011 13578049 ~ 13595097 (+)
G426312 NA other downstream 2708608 14330048 ~ 14330886 (+)
G426828 NA other downstream 3327450 14948890 ~ 14950592 (+)
G427860 NA other downstream 4264014 15885454 ~ 15889591 (+)

Expression


Co-expression Network