G425559


Basic Information

Item Value
gene id G425559
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 11672362 ~ 11672698 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU488666
CTGACAACAGAAACGTATTTACAGAAAACTCTCTTATAAAAATCTTAAAAGAGCCTCAAGAGTCGCTCAGCAAAAGACACAGAGCTGAAGACACTCCATTGAGAAGCCTGTAGATCTTCTTCACTGTTTATACTGTAAAAGTCACATTTAATCAGTCATAATCCTCGTAGTGTACACTGAGAAGCCAAAAGCAGGTTCACAAAACACAGCCAAAGCAATGACAGCTCTTCAGCAGGAGGCAGTGTGATTCTGTATGTGCTAGACGGACACCAATTAAATGGCTCAGATGGCATGACTTTACACTACAACAATGTCCACCTCTCCAATCAGCTTTGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU488666 True 337 lncRNA 0.41 1 11672362 11672698

Neighbor

gene id symbol gene type direction distance location
CI01000304_11665326_11670757 CCT8 coding downstream 1402 11665259 ~ 11670960 (-)
CI01000304_11654405_11655792 NA coding downstream 16346 11653935 ~ 11656016 (-)
CI01000304_11638983_11647850 TMEM135 coding downstream 23277 11638413 ~ 11649085 (-)
CI01000304_11575414_11578638 NA coding downstream 93724 11575328 ~ 11578638 (-)
CI01000304_11526057_11569114 NA coding downstream 103248 11525999 ~ 11569114 (-)
CI01000304_11706322_11747949 GRIK1B, GRIK1, GRIK2, GRIK1A coding upstream 33517 11706215 ~ 11747949 (-)
CI01000304_11769604_11771720 NA coding upstream 96844 11769542 ~ 11771720 (-)
CI01000304_11773915_11805873 TIAM1B, TIAM1 coding upstream 100148 11772846 ~ 11808328 (-)
CI01000304_11845828_11848857 SOD1 coding upstream 172916 11845614 ~ 11849163 (-)
CI01000304_11850324_11861609 SCAF4, SCAF4A coding upstream 177079 11849777 ~ 11861609 (-)
G425533 NA non-coding downstream 73096 11598889 ~ 11599266 (-)
G425517 NA non-coding downstream 92930 11579231 ~ 11579432 (-)
G425479 NA non-coding downstream 224408 11447627 ~ 11447954 (-)
G425269 NA non-coding downstream 242212 11429617 ~ 11430150 (-)
G425204 NA non-coding downstream 391158 11280976 ~ 11281204 (-)
G425549 NA non-coding upstream 23896 11696594 ~ 11698398 (-)
G425550 NA non-coding upstream 28466 11701164 ~ 11703380 (-)
G425582 NA non-coding upstream 218262 11890960 ~ 11891233 (-)
G425992 NA non-coding upstream 311919 11984617 ~ 11984915 (-)
G425993 NA non-coding upstream 312630 11985328 ~ 11985695 (-)
CI01000304_11338304_11348212 ILK other downstream 315216 11338019 ~ 11348212 (-)
G424808 NA other downstream 1129697 10444355 ~ 10542665 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK other downstream 1479467 10190574 ~ 10192357 (-)
CI01000304_10160458_10161768 VAMP2 other downstream 1508032 10160458 ~ 10163762 (-)
CI01000304_09737662_09738777 NA other downstream 1932891 9736746 ~ 9738777 (-)
G425580 NA other upstream 195979 11868677 ~ 11872906 (-)
G426106 NA other upstream 664003 12336701 ~ 12340228 (-)
CI01000304_12559311_12559998 NA other upstream 886156 12558854 ~ 12560135 (-)
G426147 NA other upstream 1023300 12719497 ~ 12805926 (-)
G427057 NA other upstream 1834943 13507641 ~ 13507922 (-)

Expression


Co-expression Network