G425404


Basic Information

Item Value
gene id G425404
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 11845543 ~ 11847015 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU488487
ATTTATTTTTGCCATCATACGGCCCATTCATTTAGTTCATAAAGACACACACACATCCAGCCTGATCAATGTTTATTGAACAAAGCAGAAATCAGAGGAAATGCACCACTTTGTAGCTATGAGAAGAAATGTACCAGAAAAACGGCTTCACATGGATAAAGTACAATTCTTTAAACATTAACTTGCCAAAAATAAAGATGTATTCATCAGTTTACTAAGTGCTTACGGGGGGATCCACATTGGTCACTAATATTTCCAAGCTGCCTCTATGATTGGAGCAGGACACTACTGAGTGATGCCTATAACACCACAGGCCAGACGACCTCCGGCATTGCCAGTTTTAAGACTTTCCTCATTGCCTCCCTTCCCCAAGTCATCCTCCTTCTCATGGATCTAGAACAGAATATACACAACAAGGTCTAATGCTGAACAGACAGTTATTGCCATTAGATCCATCACAGATTATAAAACCATAGAGTTGTTTTCTTACCACCATGGTCCTCCCAATGATGGAGTCTGGCCCTGACAGGGTCAGCATTTTGTCCACAATGTCAATTTTTGCAACCCCATTTTCACCAGCTATCACATTACCAAGGTCTCCGACGTGTCTTTCACTATCGGTTGGTCCACCGTGATTTTTACTGTAAGGGTTGAAGTGCGGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU488487 True 663 lncRNA 0.42 2 11845543 11847015

Neighbor

gene id symbol gene type direction distance location
CI01000304_11812792_11817948 NA coding upstream 27130 11812514 ~ 11818413 (+)
CI01000304_11685224_11691071 NA coding upstream 154472 11685224 ~ 11691071 (+)
CI01000304_11676155_11681977 MAP3K7CL coding upstream 162412 11676155 ~ 11683131 (+)
CI01000304_11613446_11620345 RAB38 coding upstream 224980 11613446 ~ 11620563 (+)
CI01000304_11582257_11610398 GRM5, GRM5A coding upstream 234932 11581808 ~ 11610611 (+)
CI01000304_11866424_11868022 UGT5D1 coding downstream 19085 11866100 ~ 11868083 (+)
CI01000304_11993486_12061098 FREM2, FREM2A coding downstream 146471 11993486 ~ 12062218 (+)
CI01000304_12065676_12071391 TRIM47 coding downstream 217804 12064381 ~ 12071430 (+)
CI01000304_12213555_12231910 NA coding downstream 365039 12212054 ~ 12232732 (+)
CI01000304_12314575_12337592 SYNJ1 coding downstream 467301 12314316 ~ 12337690 (+)
G425443 NA non-coding upstream 1008 11844231 ~ 11844535 (+)
G425442 NA non-coding upstream 1402 11843925 ~ 11844141 (+)
G425441 NA non-coding upstream 3304 11841784 ~ 11842239 (+)
G425435 NA non-coding upstream 8940 11836312 ~ 11836603 (+)
G425385 NA non-coding upstream 100921 11737683 ~ 11744622 (+)
G425447 NA non-coding downstream 5098 11852113 ~ 11853772 (+)
G425449 NA non-coding downstream 10614 11857629 ~ 11858050 (+)
G425462 NA non-coding downstream 43918 11890933 ~ 11891233 (+)
G425466 NA non-coding downstream 74647 11921662 ~ 11921962 (+)
G425602 NA non-coding downstream 129783 11976798 ~ 11984503 (+)
CI01000304_10555326_10571933 NA other upstream 1289839 10555216 ~ 10572164 (+)
G424251 NA other upstream 1652648 10188822 ~ 10189404 (+)
G424246 NA other upstream 1718221 10116343 ~ 10127322 (+)
CI01000304_09564068_09565679 HRH2B other upstream 2279970 9561005 ~ 9565778 (+)
G423614 NA other upstream 2896121 8949036 ~ 8949422 (+)
G425718 NA other downstream 581690 12436554 ~ 12436605 (+)
CI01000304_13578347_13595075 NA other downstream 1709436 13578049 ~ 13595097 (+)
G426312 NA other downstream 2483033 14330048 ~ 14330886 (+)
G426828 NA other downstream 3101875 14948890 ~ 14950592 (+)
G427860 NA other downstream 4038439 15885454 ~ 15889591 (+)

Expression


Co-expression Network