G426103


Basic Information

Item Value
gene id G426103
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 12296556 ~ 12296831 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU489282
AGTGTAAATAATGAGAGAACTTCCATTTTTGGGTGAACTATCCCTTAACCTAACCATTTTGTCCAGATTTTATTTATGCAGCTCATGTTTCGATGCCAGCAATAAGCTCACCCTGAAAACCAGCACCATATCACAGTGCCAGGATATGTGGAGGGTCCTGTTCCTTGCTTCTGTCTCCCATCTCCTCTCTAACCACATTGGTGTTACAAATTGACAGGCTATTTATTTTCAAACTCAAATATAGATCAGCACGCTGCGTTTCAAACCACAGGCCCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU489282 True 276 lncRNA 0.42 1 12296556 12296831

Neighbor

gene id symbol gene type direction distance location
CI01000304_12254455_12256896 DCHS1 coding downstream 38445 12254112 ~ 12258111 (-)
CI01000304_12249076_12249428 NA coding downstream 46834 12248566 ~ 12249722 (-)
CI01000304_12166589_12192298 NA coding downstream 104258 12165990 ~ 12192298 (-)
CI01000304_12123700_12132292 ARFIP2B, ARFIP2 coding downstream 164050 12123409 ~ 12132506 (-)
CI01000304_12111812_12118998 NA coding downstream 176313 12111519 ~ 12120243 (-)
CI01000304_12305300_12310341 SLC46A3 coding upstream 6789 12303620 ~ 12310341 (-)
CI01000304_12409495_12416078 FGF13.L, FGF13A, FGF13B, FGF13 coding upstream 112066 12408897 ~ 12416078 (-)
CI01000304_12442703_12460793 NA coding upstream 145865 12442696 ~ 12461728 (-)
CI01000304_12552338_12553936 NA coding upstream 255449 12552280 ~ 12553936 (-)
CI01000304_12555015_12556002 MRPL49 coding upstream 257895 12554726 ~ 12556002 (-)
G426092 NA non-coding downstream 24565 12271788 ~ 12271991 (-)
G426071 NA non-coding downstream 151197 12145055 ~ 12145359 (-)
G426065 NA non-coding downstream 191891 12104444 ~ 12104665 (-)
G426025 NA non-coding downstream 228156 12068028 ~ 12068400 (-)
G426061 NA non-coding downstream 231519 12064379 ~ 12065037 (-)
G426016 NA non-coding upstream 16796 12313627 ~ 12316312 (-)
G426110 NA non-coding upstream 65887 12362718 ~ 12363607 (-)
G426113 NA non-coding upstream 69403 12366234 ~ 12366809 (-)
G426114 NA non-coding upstream 70525 12367356 ~ 12367911 (-)
G426115 NA non-coding upstream 72510 12369341 ~ 12369624 (-)
G425580 NA other downstream 423650 11868677 ~ 11872906 (-)
CI01000304_11338304_11348212 ILK other downstream 939410 11338019 ~ 11348212 (-)
G424808 NA other downstream 1753891 10444355 ~ 10542665 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK other downstream 2103661 10190574 ~ 10192357 (-)
CI01000304_10160458_10161768 VAMP2 other downstream 2132226 10160458 ~ 10163762 (-)
G426106 NA other upstream 39870 12336701 ~ 12340228 (-)
CI01000304_12559311_12559998 NA other upstream 262023 12558854 ~ 12560135 (-)
G426147 NA other upstream 399167 12719497 ~ 12805926 (-)
G427057 NA other upstream 1210810 13507641 ~ 13507922 (-)
G427154 NA other upstream 1634960 13931791 ~ 13950548 (-)

Expression


Co-expression Network