G426188



Basic Information


Item Value
gene id G426188
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 12589913 ~ 12590112 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU489395
CAGATTCTCAAATCTCAAGTCAGCAGTCAGGAATACTGCCCTTTCCACCCTGCAAGGTCTCAAGAGTTCAATTCATTTTGTCATACTTAGTCAGCCCCATGTATATTTTATGCCCTTTGCTCTTCAGCTCATTGAAAATGTTTCCATGTTTAATTATCTGTCATGTTGAAAGTGTCACTTATTAGATGCACTTAACAACC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU489395 True 200 lncRNA 0.39 1 12589913 12590112

Neighbor


gene id symbol gene type direction distance location
CI01000304_12570121_12574061 CNIH2 coding downstream 15852 12570059 ~ 12574061 (-)
CI01000304_12559311_12559998 NA coding downstream 29915 12558854 ~ 12560135 (-)
CI01000304_12558231_12558565 NA coding downstream 31323 12558086 ~ 12558741 (-)
CI01000304_12555015_12556002 MRPL49 coding downstream 33911 12554726 ~ 12556002 (-)
CI01000304_12552338_12553936 NA coding downstream 35977 12552280 ~ 12553936 (-)
CI01000304_12687020_12696284 AUTS2, AUTS2A coding upstream 96345 12686457 ~ 12696284 (-)
CI01000304_12887576_12889393 NA coding upstream 297112 12887224 ~ 12889393 (-)
CI01000304_12953008_12953457 NA coding upstream 362592 12952704 ~ 12953480 (-)
CI01000304_13036242_13039203 NA coding upstream 444573 13034685 ~ 13039315 (-)
CI01000304_13068737_13075920 NA coding upstream 478390 13068502 ~ 13075920 (-)
G426184 NA non-coding downstream 693 12588923 ~ 12589220 (-)
G426142 NA non-coding downstream 54709 12534071 ~ 12535204 (-)
G426170 NA non-coding downstream 94078 12495626 ~ 12495835 (-)
G426127 NA non-coding downstream 116182 12468037 ~ 12473731 (-)
G426135 NA non-coding upstream 31355 12621467 ~ 12625378 (-)
G426147 NA non-coding upstream 105886 12719497 ~ 12805926 (-)
G427020 NA non-coding upstream 505311 13095423 ~ 13095773 (-)
G427023 NA non-coding upstream 511333 13101445 ~ 13101719 (-)
G427025 NA non-coding upstream 514466 13104578 ~ 13104792 (-)
G426106 NA other downstream 249685 12336701 ~ 12340228 (-)
G425580 NA other downstream 717007 11868677 ~ 11872906 (-)
CI01000304_11338304_11348212 ILK other downstream 1232767 11338019 ~ 11348212 (-)
G424808 NA other downstream 2047248 10444355 ~ 10542665 (-)
G427057 NA other upstream 917529 13507641 ~ 13507922 (-)
G427154 NA other upstream 1341679 13931791 ~ 13950548 (-)
G427309 NA other upstream 1599356 14181932 ~ 14237078 (-)
CI01000304_14265881_14269102 NA other upstream 1678311 14265476 ~ 14269571 (-)

Expression



Co-expression Network