G425817



Basic Information


Item Value
gene id G425817
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 12688849 ~ 12689076 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU488979
CCTTGTTGACTGATGAATCCCTCTTGTCCAGGTCACGTTCTCTTTCCCTGTCCCTTTCTCGTTCTCTCTCATGTGAGCTGACTGACGCGCTGCGTTCCGAGTCTCCGGGTTTGAGCCAGGGAGGTGGGGTGGGGAAGGAAGGCGGAGTGCGGTGGAGTCTGTTCCATGGCTCGTGGGGTCCGCTGAAGTGCTGTTGTGCGCTGGGTGCATCTTTGTGGCCAAATACAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU488979 True 228 lncRNA 0.58 1 12688849 12689076
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000304_12653236_12670625 CXADR coding upstream 17866 12652837 ~ 12670983 (+)
CI01000304_12601154_12621980 EHD1B, EHD1 coding upstream 66856 12600836 ~ 12621993 (+)
CI01000304_12583384_12588591 WDR74 coding upstream 99785 12583384 ~ 12589788 (+)
CI01000304_12569155_12569469 NA coding upstream 119115 12569155 ~ 12569734 (+)
CI01000304_12556446_12557806 FAUB, UBIM, FAU coding upstream 130773 12556446 ~ 12558076 (+)
CI01000304_12718988_12729338 NA coding downstream 29691 12718767 ~ 12729850 (+)
CI01000304_12744525_12773999 NA coding downstream 54983 12744059 ~ 12774312 (+)
CI01000304_12819247_12825161 NA coding downstream 128903 12817979 ~ 12825313 (+)
CI01000304_12828251_12839287 NA coding downstream 138238 12827314 ~ 12839991 (+)
CI01000304_13331382_13338351 RNFT1 coding downstream 642306 13331382 ~ 13339248 (+)
G425816 NA non-coding upstream 249 12686128 ~ 12688600 (+)
G425830 NA non-coding upstream 3923 12684657 ~ 12684926 (+)
G425812 NA non-coding upstream 94984 12591256 ~ 12593865 (+)
G425796 NA non-coding upstream 127424 12561074 ~ 12561425 (+)
G425831 NA non-coding downstream 358 12689434 ~ 12689765 (+)
G425832 NA non-coding downstream 1353 12690429 ~ 12691062 (+)
G425835 NA non-coding downstream 4008 12693084 ~ 12694418 (+)
G425834 NA non-coding downstream 5542 12694618 ~ 12694890 (+)
G425930 NA non-coding downstream 200255 12889331 ~ 13036691 (+)
G425718 NA other upstream 249763 12436554 ~ 12436605 (+)
CI01000304_10555326_10571933 NA other upstream 2133145 10555216 ~ 10572164 (+)
G424251 NA other upstream 2495954 10188822 ~ 10189404 (+)
G424246 NA other upstream 2561527 10116343 ~ 10127322 (+)
CI01000304_09564068_09565679 HRH2B other upstream 3123276 9561005 ~ 9565778 (+)
CI01000304_13578347_13595075 NA other downstream 867375 13578049 ~ 13595097 (+)
G426312 NA other downstream 1640972 14330048 ~ 14330886 (+)
G426828 NA other downstream 2259814 14948890 ~ 14950592 (+)
G427860 NA other downstream 3196378 15885454 ~ 15889591 (+)
G428017 NA other downstream 3394154 16083230 ~ 16083714 (+)

Expression


G425817 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G425817 Expression in each Bioproject

Bar chart with 10 bars.
G425817 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network