G427025


Basic Information

Item Value
gene id G427025
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 13104578 ~ 13104792 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU490296
CATCATTTGCCGCGTGGTGAGCCGGGCACTACGCAATTGTTTCATAACTTCAGGAATGTGCAATGAATTTAAAGAAGGAACAGATGAAACCGACTGGATCCACAGAAGAACATGAGGCAAAACTCATAAAAACTAATCAAAACCTCTTTTCACCCAGACTTGGGCCCTTATATGAGGTCAGAAAAACTGGAAAGAAATTGTGGCTTGGCTGGAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU490296 True 215 lncRNA 0.43 1 13104578 13104792

Neighbor

gene id symbol gene type direction distance location
CI01000304_13068737_13075920 NA coding downstream 28658 13068502 ~ 13075920 (-)
CI01000304_13036242_13039203 NA coding downstream 65375 13034685 ~ 13039315 (-)
CI01000304_12953008_12953457 NA coding downstream 151098 12952704 ~ 12953480 (-)
CI01000304_12887576_12889393 NA coding downstream 215185 12887224 ~ 12889393 (-)
CI01000304_12687020_12696284 AUTS2, AUTS2A coding downstream 408294 12686457 ~ 12696284 (-)
CI01000304_13185020_13207799 INTS2 coding upstream 79426 13184218 ~ 13207799 (-)
CI01000304_13210441_13259571 MED13, MED13A coding upstream 104936 13209728 ~ 13262698 (-)
CI01000304_13276793_13278145 NA coding upstream 171455 13276247 ~ 13278145 (-)
CI01000304_13342458_13361412 RPS6KB1A coding upstream 237628 13342420 ~ 13361412 (-)
CI01000304_13367200_13384209 NA coding upstream 261755 13365346 ~ 13395129 (-)
G427023 NA non-coding downstream 2859 13101445 ~ 13101719 (-)
G427020 NA non-coding downstream 8805 13095423 ~ 13095773 (-)
G426147 NA non-coding downstream 383452 12719497 ~ 12805926 (-)
G426135 NA non-coding downstream 479200 12621467 ~ 12625378 (-)
G426188 NA non-coding downstream 514466 12589913 ~ 12590112 (-)
G427042 NA non-coding upstream 36041 13140833 ~ 13141045 (-)
G426990 NA non-coding upstream 228545 13333337 ~ 13364683 (-)
G427009 NA non-coding upstream 268294 13373086 ~ 13373659 (-)
G426995 NA non-coding upstream 274374 13379166 ~ 13379942 (-)
CI01000304_12559311_12559998 NA other downstream 544443 12558854 ~ 12560135 (-)
G426106 NA other downstream 764350 12336701 ~ 12340228 (-)
G425580 NA other downstream 1231672 11868677 ~ 11872906 (-)
CI01000304_11338304_11348212 ILK other downstream 1747432 11338019 ~ 11348212 (-)
G427057 NA other upstream 402849 13507641 ~ 13507922 (-)
G427154 NA other upstream 826999 13931791 ~ 13950548 (-)
G427309 NA other upstream 1084676 14181932 ~ 14237078 (-)
CI01000304_14265881_14269102 NA other upstream 1163631 14265476 ~ 14269571 (-)
CI01000304_14286960_14294449 NA other upstream 1178879 14286960 ~ 14294449 (-)

Expression


Co-expression Network