G427052



Basic Information


Item Value
gene id G427052
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 13502150 ~ 13502415 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU490323
TGTCTTTGTAAAGAAATGCTCACTTTATATGTAGCTTCGAGCCGCTGCTGTGACGCTGTACAAACGCTTCCAGTGTGAATACTCGCGCGTCTCTGTCCCTGCAGTGACGATGTAGTTACGCTCACGCGCTGCTCACGCGCCGCTCACGCTTGCAGTGTGAAACAGGCGTGAGTCGTGTTCCGTACTCACATGTTAATGATAATTTAGGGGATTCACTCCCGCATTTAAAAACTTAAAGTGTGTACGTGGTCATTGTTTGTGTGGAA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU490323 True 266 lncRNA 0.48 1 13502150 13502415

Neighbor


gene id symbol gene type direction distance location
CI01000304_13479162_13481853 BTG3 coding downstream 19856 13478741 ~ 13482294 (-)
CI01000304_13444023_13466208 CLTCB, CLTCA, CLTC coding downstream 35942 13444023 ~ 13466208 (-)
CI01000304_13406343_13432947 NA coding downstream 68539 13403026 ~ 13433611 (-)
CI01000304_13367200_13384209 NA coding downstream 117612 13365346 ~ 13395129 (-)
CI01000304_13342458_13361412 RPS6KB1A coding downstream 140738 13342420 ~ 13361412 (-)
CI01000304_13517595_13527868 NA coding upstream 14761 13517176 ~ 13527868 (-)
CI01000304_13529418_13530787 NA coding upstream 26715 13529130 ~ 13530787 (-)
CI01000304_13532811_13534129 NA coding upstream 30396 13532811 ~ 13534129 (-)
CI01000304_13541959_13564807 NA coding upstream 38810 13541225 ~ 13564807 (-)
CI01000304_13692322_13711234 ALCAMA coding upstream 189543 13691958 ~ 13711234 (-)
G427050 NA non-coding downstream 2886 13499032 ~ 13499264 (-)
G427049 NA non-coding downstream 16065 13485756 ~ 13486085 (-)
G426991 NA non-coding downstream 102480 13398380 ~ 13399670 (-)
G426995 NA non-coding downstream 122208 13379166 ~ 13379942 (-)
G427055 NA non-coding upstream 3430 13505845 ~ 13506072 (-)
G427000 NA non-coding upstream 7664 13510079 ~ 13513826 (-)
G427064 NA non-coding upstream 86732 13589147 ~ 13589370 (-)
G427076 NA non-coding upstream 106971 13609386 ~ 13609600 (-)
G426147 NA other downstream 462835 12719497 ~ 12805926 (-)
CI01000304_12559311_12559998 NA other downstream 942015 12558854 ~ 12560135 (-)
G426106 NA other downstream 1161922 12336701 ~ 12340228 (-)
G425580 NA other downstream 1629244 11868677 ~ 11872906 (-)
CI01000304_11338304_11348212 ILK other downstream 2145004 11338019 ~ 11348212 (-)
G427057 NA other upstream 5226 13507641 ~ 13507922 (-)
G427154 NA other upstream 429376 13931791 ~ 13950548 (-)
G427309 NA other upstream 687053 14181932 ~ 14237078 (-)
CI01000304_14265881_14269102 NA other upstream 766008 14265476 ~ 14269571 (-)
CI01000304_14286960_14294449 NA other upstream 781256 14286960 ~ 14294449 (-)

Expression



Co-expression Network