G426851


Basic Information

Item Value
gene id G426851
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 14941924 ~ 14942214 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU490085
GTGTGCAAATCTTTCAGGGGAGCAAGAATGTTTTTGAAATGTTTGACGACGAGCAGTTAATCAAACGGTATCATTTGGACAAAGAAAGGCATCATCTTTTCAGCGCTGGTTAATGTTTGGCTGAATTGTTCTACTAATTCAGCAAGCAGTAGAGCTTCTTCCTCACGCAGGTTCGGTTTTCTTTTAAAATCCATGGTGACTGATTATATCATAAAATCTAGGCTACATATAGGCAGGTCAGTTAGCAGCACACCGGTTTAAAATGTGCAATTAAAACTTGGTGAAAAATTT

Function

NR:

description
C3 and PZP-like alpha-2-macroglobulin domain-containing protein 8

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU490085 True 291 lncRNA 0.38 1 14941924 14942214

Neighbor

gene id symbol gene type direction distance location
CI01000304_14695603_14740389 NTM coding upstream 200845 14695603 ~ 14741079 (+)
CI01000304_14356867_14373980 NA coding upstream 567258 14356586 ~ 14374666 (+)
CI01000304_14352375_14355516 HSP70, HSP7C, HSPA8, HSPA1L.S coding upstream 586408 14352375 ~ 14355516 (+)
CI01000304_14331169_14331855 HIST1H2AD.L, HIST2H2AB, H2AFX.L, HIST1H2AH, HIST1H2AJ coding upstream 609951 14331064 ~ 14331973 (+)
CI01000304_14304022_14317252 HYOU1 coding upstream 623899 14304022 ~ 14318025 (+)
CI01000304_15034188_15038152 TMEM218 coding downstream 90003 15032081 ~ 15038498 (+)
CI01000304_15040739_15045239 NA coding downstream 98338 15040552 ~ 15045257 (+)
CI01000304_15047768_15063987 ROBO4 coding downstream 105554 15047768 ~ 15064170 (+)
CI01000304_15140709_15147357 NA coding downstream 198347 15140561 ~ 15147557 (+)
CI01000304_15148523_15151340 NA coding downstream 205620 15147834 ~ 15151395 (+)
G426834 NA non-coding upstream 9997 14931691 ~ 14931927 (+)
G426833 NA non-coding upstream 11131 14930508 ~ 14930793 (+)
G426825 NA non-coding upstream 33428 14908128 ~ 14908496 (+)
G426814 NA non-coding upstream 50469 14891231 ~ 14891455 (+)
G426813 NA non-coding upstream 51477 14890204 ~ 14890447 (+)
G426853 NA non-coding downstream 1430 14943644 ~ 14943860 (+)
G426920 NA non-coding downstream 207628 15149842 ~ 15150398 (+)
G426923 NA non-coding downstream 233065 15175279 ~ 15175635 (+)
G426928 NA non-coding downstream 252095 15194309 ~ 15194689 (+)
G426312 NA other upstream 611038 14330048 ~ 14330886 (+)
CI01000304_13578347_13595075 NA other upstream 1363077 13578049 ~ 13595097 (+)
G425718 NA other upstream 2502838 12436554 ~ 12436605 (+)
CI01000304_10555326_10571933 NA other upstream 4386220 10555216 ~ 10572164 (+)
G424251 NA other upstream 4749029 10188822 ~ 10189404 (+)
G426828 NA other downstream 6676 14948890 ~ 14950592 (+)
G427860 NA other downstream 943240 15885454 ~ 15889591 (+)
G428017 NA other downstream 1141016 16083230 ~ 16083714 (+)
CI01000304_16505174_16506124 NA other downstream 1562648 16504764 ~ 16513625 (+)
CI01000304_16761621_16764983 EXOSC8 other downstream 1813732 16761372 ~ 16765057 (+)

Expression


Co-expression Network