G427721


Basic Information

Item Value
gene id G427721
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 15460387 ~ 15460626 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU491126
TGATGATCGATTCAGGCAGCAATCGGCCTCCAAAAGGAGGCTATATATAAACTATTATCGCAACGATAGCCAATCATTCAGGCAAATTTAGTCGGGCTTATTTGTTTGTGAGAGTCTAATGTATATGATCGTATGTAAATTAGTATTTACCTTAAAGGATATCGATTCTGAGCAATTTATTTGAATTTCAACTACGGGATAGAACAATTGTTTCTAAAAATCGACAGTTTTTGTTTTCAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU491126 True 240 lncRNA 0.34 1 15460387 15460626

Neighbor

gene id symbol gene type direction distance location
CI01000304_15423818_15456305 LHFP coding upstream 3506 15421611 ~ 15456881 (+)
CI01000304_15348138_15379777 FOXO1B, FOXO1 coding upstream 80384 15347958 ~ 15380003 (+)
CI01000304_15315146_15318470 ESAMA coding upstream 140400 15315146 ~ 15319987 (+)
CI01000304_15265823_15269133 MSANTD2 coding upstream 190796 15264968 ~ 15269591 (+)
CI01000304_15231039_15234179 NA coding upstream 225804 15231039 ~ 15234583 (+)
CI01000304_15462162_15465511 NA coding downstream 1536 15462162 ~ 15465511 (+)
CI01000304_15467093_15471138 PRKRIRA coding downstream 6467 15467093 ~ 15471482 (+)
CI01000304_15472687_15483327 NA coding downstream 12061 15472687 ~ 15483327 (+)
CI01000304_15483378_15486113 NA coding downstream 22752 15483378 ~ 15486386 (+)
CI01000304_15500233_15509862 WNT11, WNT11.L, WNT11R coding downstream 39607 15500233 ~ 15510716 (+)
G426931 NA non-coding upstream 118571 15339294 ~ 15341816 (+)
G426933 NA non-coding upstream 126702 15322016 ~ 15333685 (+)
G426951 NA non-coding upstream 205148 15253925 ~ 15255239 (+)
G426941 NA non-coding upstream 237686 15221621 ~ 15222701 (+)
G426930 NA non-coding upstream 257401 15202649 ~ 15202986 (+)
G427723 NA non-coding downstream 29693 15490319 ~ 15490525 (+)
G427737 NA non-coding downstream 82391 15543017 ~ 15543311 (+)
G427739 NA non-coding downstream 90335 15550961 ~ 15551196 (+)
G427746 NA non-coding downstream 106477 15567103 ~ 15567331 (+)
G427748 NA non-coding downstream 107468 15568094 ~ 15568303 (+)
G426828 NA other upstream 509795 14948890 ~ 14950592 (+)
G426312 NA other upstream 1129501 14330048 ~ 14330886 (+)
CI01000304_13578347_13595075 NA other upstream 1881540 13578049 ~ 13595097 (+)
G425718 NA other upstream 3021301 12436554 ~ 12436605 (+)
CI01000304_10555326_10571933 NA other upstream 4904683 10555216 ~ 10572164 (+)
G427860 NA other downstream 424828 15885454 ~ 15889591 (+)
G428017 NA other downstream 622604 16083230 ~ 16083714 (+)
CI01000304_16505174_16506124 NA other downstream 1044236 16504764 ~ 16513625 (+)
CI01000304_16761621_16764983 EXOSC8 other downstream 1295320 16761372 ~ 16765057 (+)
CI01000304_17009769_17023302 ZDHHC20, ZDHHC20A other downstream 1550104 17009769 ~ 17023882 (+)

Expression


Co-expression Network