G428376



Basic Information


Item Value
gene id G428376
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 15487379 ~ 15487595 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU491876
CGCATATACTACCGCTCTCACAAGAAATGACCCTAAAAGGTCAAAGACTCTAGCCCCCAAGGGTGAATCATAGGTCCAAGGTTACATGGAAATGGGAGACTGATTGCTTCTCAACGACATCTCGAAATCCACTCCTGAAAACAATATTCTATGATGGATCTGCAGTCTATGAACCAAAAGGCTAAAGAATGGCTGCAAATCATCGACAGGCTACAGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU491876 True 217 lncRNA 0.44 1 15487379 15487595
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000304_15341701_15346353 VPS26BL, V26BL, VPS26B, V26BB coding downstream 140201 15340565 ~ 15347178 (-)
CI01000304_15322368_15331609 FEZ1 coding downstream 155640 15321790 ~ 15331739 (-)
CI01000304_15132805_15136196 ROBO3, ROBO2 coding downstream 351183 15132227 ~ 15136196 (-)
CI01000304_15075003_15110723 ROBO3 coding downstream 376383 15074301 ~ 15110996 (-)
CI01000304_14957226_14983228 PKNOX2 coding downstream 504151 14956603 ~ 14983228 (-)
CI01000304_15584327_15694046 UVRAG coding upstream 96732 15584327 ~ 15694046 (-)
CI01000304_15703390_15711806 DGAT2 coding upstream 215577 15703172 ~ 15712119 (-)
CI01000304_15715861_15722546 MOGAT2 coding upstream 227829 15715424 ~ 15722546 (-)
CI01000304_15755554_15770449 NA coding upstream 266881 15754452 ~ 15770768 (-)
CI01000304_15782838_15784193 ATG101, ATG101.L coding upstream 295132 15782727 ~ 15784193 (-)
G428340 NA non-coding downstream 20868 15465925 ~ 15466511 (-)
G427657 NA non-coding downstream 211710 15275216 ~ 15275669 (-)
G427632 NA non-coding downstream 283878 15203264 ~ 15203501 (-)
G427631 NA non-coding downstream 292720 15194276 ~ 15194659 (-)
G427588 NA non-coding downstream 571708 14915463 ~ 14915671 (-)
G428377 NA non-coding upstream 332 15487927 ~ 15488140 (-)
G428378 NA non-coding upstream 862 15488457 ~ 15488714 (-)
G428379 NA non-coding upstream 2214 15489809 ~ 15490014 (-)
G428383 NA non-coding upstream 10820 15498415 ~ 15503512 (-)
G428382 NA non-coding upstream 17159 15504754 ~ 15510980 (-)
G427376 NA other downstream 225974 15258964 ~ 15261405 (-)
G427423 NA other downstream 1125487 14361448 ~ 14361892 (-)
CI01000304_14286960_14294449 NA other downstream 1199775 14286960 ~ 14294449 (-)
CI01000304_14265881_14269102 NA other downstream 1217808 14265476 ~ 14269571 (-)
G427309 NA other downstream 1279080 14181932 ~ 14237078 (-)
CI01000304_16769537_16780398 SUPT20, SUPT20H other upstream 1291769 16769417 ~ 16780398 (-)
CI01000304_16854877_16860888 YPEL2A, YPEL2B, YPEL1, YPEL2, YPEL1.L, YPELD, YPELC other upstream 1366970 16854565 ~ 16860911 (-)
G429331 NA other upstream 2436268 17923863 ~ 17924684 (-)
G429499 NA other upstream 2750124 18237719 ~ 18238319 (-)
G429673 NA other upstream 3098847 18586442 ~ 18591856 (-)

Expression


G428376 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G428376 Expression in each Bioproject

Bar chart with 19 bars.
G428376 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network