G429216


Basic Information

Item Value
gene id G429216
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 17529318 ~ 17529711 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU492823
TTTTTTGAAACCACACTAATGGGGAAGACTGCTGACTTGGCAATGGTCCAGGAGACAATCATTGACACCCTCCACAAAGAGAGTAAGTCACAGAAGGTCATTACTGAATGGGGTGGCTGTTTACAGAGTGATGTATCAAAGCATATTAAATGCAAAGTTGACTGGAAGGAAGAAATTGGGTAGGCAAAGGTGCACAAGCAACAGGGATGACCGCAAGCTTGAGAATACTGTCAAGTAAAGCTGATTCAAACACTTGGGAGAGCTTCACAATGAGTAGAATGAAGCCGGAGTCAGCGCATCAAGAGTCACCACACTCAGACATCTTCAGGAAAAGGACTACCAAGCCACTTCTGAACCAGAGACAACGTCAGAAGCATCTTACCTGGGCTAAGGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU492823 True 394 lncRNA 0.45 1 17529318 17529711

Neighbor

gene id symbol gene type direction distance location
CI01000304_17488992_17490128 NA coding downstream 38824 17488124 ~ 17490494 (-)
CI01000304_17413669_17414667 OR109-1 coding downstream 114410 17413514 ~ 17414908 (-)
CI01000304_17369357_17411120 NA coding downstream 118115 17369154 ~ 17411203 (-)
CI01000304_17348461_17354382 NA coding downstream 174696 17348079 ~ 17354622 (-)
CI01000304_17332233_17338077 NA coding downstream 191241 17332233 ~ 17338077 (-)
CI01000304_17538160_17540583 UBL3A, UBL3.S, UBL3 coding upstream 8449 17538160 ~ 17540583 (-)
CI01000304_17571701_17576895 KATNAL1 coding upstream 41513 17571224 ~ 17576895 (-)
CI01000304_17579139_17581078 NA coding upstream 49407 17579118 ~ 17581601 (-)
CI01000304_17582446_17582872 NA coding upstream 52533 17582244 ~ 17582872 (-)
CI01000304_17584110_17585466 HMGB1B, HMGB1, HMGB1A coding upstream 54149 17583860 ~ 17585669 (-)
G429266 NA non-coding downstream 5603 17523382 ~ 17523715 (-)
G429172 NA non-coding downstream 169226 17344902 ~ 17360092 (-)
G428912 NA non-coding downstream 205763 17323213 ~ 17323555 (-)
G428909 NA non-coding downstream 212837 17316280 ~ 17316481 (-)
G428863 NA non-coding downstream 293622 17235442 ~ 17235696 (-)
G429238 NA non-coding upstream 34389 17564100 ~ 17564398 (-)
G429220 NA non-coding upstream 35991 17565702 ~ 17568817 (-)
G429202 NA non-coding upstream 130163 17659874 ~ 17704143 (-)
G429224 NA non-coding upstream 189235 17718946 ~ 17794447 (-)
G429300 NA non-coding upstream 291049 17820760 ~ 17821223 (-)
CI01000304_16854877_16860888 YPEL2A, YPEL2B, YPEL1, YPEL2, YPEL1.L, YPELD, YPELC other downstream 662080 16854565 ~ 16860911 (-)
CI01000304_16769537_16780398 SUPT20, SUPT20H other downstream 748359 16769417 ~ 16780398 (-)
G427376 NA other downstream 2267913 15258964 ~ 15261405 (-)
G427423 NA other downstream 3167426 14361448 ~ 14361892 (-)
CI01000304_14286960_14294449 NA other downstream 3241714 14286960 ~ 14294449 (-)
G429331 NA other upstream 394152 17923863 ~ 17924684 (-)
G429499 NA other upstream 708008 18237719 ~ 18238319 (-)
G429673 NA other upstream 1056731 18586442 ~ 18591856 (-)

Expression


Co-expression Network