CI01000306_01008614_01011977 (RALB.S, RALBA, RALBB, RALB.L, RALB)



Basic Information


Item Value
gene id CI01000306_01008614_01011977
gene name RALB.S, RALBA, RALBB, RALB.L, RALB
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 1008614 ~ 1011977 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>CI01000306_01008614_01011977.mRNA
AACACTAAAGTCATGGCAGCAAATAAGAGCAAAAATCAGAGTTCGCTGGTGCTGCACAAGGTGATCATGGTGGGCAGCGGCGGCGTGGGAAAATCCGCCCTCACGCTGCAGTTCATGTATGACGAGTTTGTGGAGGACTACGAACCCACCAAGGCTGACAGTTACAGGAAGAAGGTGGTCCTGGATGGAGAGGAGGTGCAGATTGATATTCTGGACACGGCGGGACAGGAAGACTACGCTGCCATCAGGGATAACTACTTCCGCAGCGGAGAGGGTTTCCTCCTGGTTTTCTCCATCACAGAGCCGGAGTCCTTCAGCGCCACGTCAGAGTTCAGGGAGCAGATCCTGAGAGTGAAAGCAGAGGAGGATAAAATCCCTCTGTTAGTGGTGGGGAATAAGTCTGATCTGGAGGACAGGAGGCAG

Function


symbol description
ralba Predicted to enable GDP binding activity; GTP binding activity; and GTPase activity. Predicted to be involved in Ras protein signal transduction. Predicted to act upstream of or within signal transduction. Predicted to be located in membrane. Predicted to be active in plasma membrane. Human ortholog(s) of this gene implicated in pancreatic adenocarcinoma. Orthologous to human RALB (RAS like proto-oncogene B).
ralbb Predicted to enable GDP binding activity; GTP binding activity; and GTPase activity. Acts upstream of or within angiogenesis. Predicted to be located in membrane. Predicted to be active in plasma membrane. Human ortholog(s) of this gene implicated in pancreatic adenocarcinoma. Orthologous to human RALB (RAS like proto-oncogene B).
ralb Enables GTPase activity; enzyme binding activity; and guanyl ribonucleotide binding activity. Involved in several processes, including cellular response to exogenous dsRNA; negative regulation of protein binding activity; and positive regulation of cellular metabolic process. Located in midbody and plasma membrane. Implicated in pancreatic adenocarcinoma.

GO:

id name namespace
GO:0060178 regulation of exocyst localization biological_process

KEGG:

id description
K07835 RALB; Ras-related protein Ral-B

RNA


RNA id representative length rna type GC content exon number start site end site
CI01000306_01008614_01011977.mRNA True 423 mRNA 0.53 3 1008614 1011977

Neighbor


gene id symbol gene type direction distance location
CI01000306_00887579_00889885 NA coding upstream 117906 887190 ~ 890708 (+)
CI01000306_00730637_00781399 CLASP1 coding upstream 227215 730637 ~ 781399 (+)
CI01000306_00705287_00711760 CLCN4 coding upstream 296029 705287 ~ 714524 (+)
CI01000306_00693218_00693943 NA coding upstream 314055 693218 ~ 694559 (+)
CI01000306_00681384_00689565 NA coding upstream 318802 681384 ~ 689812 (+)
CI01000306_01047698_01080329 TMEM63A, TMEM63B coding downstream 35721 1047698 ~ 1082259 (+)
CI01000306_01209847_01210850 ACYP2 coding downstream 197418 1209395 ~ 1211232 (+)
CI01000306_01224349_01255175 NA coding downstream 212173 1224150 ~ 1255472 (+)
CI01000306_01278230_01279369 NA coding downstream 266253 1278230 ~ 1279484 (+)
CI01000306_01293889_01308316 SPTBN1 coding downstream 281691 1293668 ~ 1308316 (+)
G430419 NA non-coding upstream 23676 984515 ~ 984938 (+)
G430389 NA non-coding upstream 94853 907323 ~ 913761 (+)
G430344 NA non-coding upstream 201862 806517 ~ 806752 (+)
G430335 NA non-coding upstream 278373 729903 ~ 730241 (+)
G430425 NA non-coding downstream 21243 1033220 ~ 1045108 (+)
G430433 NA non-coding downstream 58391 1070368 ~ 1071227 (+)
G430397 NA non-coding downstream 70551 1082528 ~ 1084265 (+)
G430434 NA non-coding downstream 83294 1095271 ~ 1095590 (+)
G430407 NA non-coding downstream 104841 1116818 ~ 1119768 (+)
G430409 NA other upstream 8712 925544 ~ 999902 (+)
CI01000306_00235686_00242814 NA other upstream 771245 235447 ~ 242861 (+)
G430452 NA other downstream 138620 1150597 ~ 1150938 (+)
G430719 NA other downstream 1136405 2148382 ~ 2150954 (+)
CI01000306_02974291_02976718 TP53INP2 other downstream 1961179 2973156 ~ 2979157 (+)
CI01000306_03772689_03777211 DYNLRB1 other downstream 2762167 3772689 ~ 3777550 (+)

Expression



Co-expression Network