G430268


Basic Information

Item Value
gene id G430268
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 212122 ~ 212353 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU494041
AAATTATTGAACTATCTTGGATTTTATTAAAATATTTTAGCTCAGAGTGTTTCTGGAGATGAAAGAGTTTGTGTGGCGCTAGCATCAGTAAGAACATGAACTGATACAATCATGTGACCGTCATGTGACCGTCATCACCGCAGGTCAGTTCGTCGAGAGCGAGCCGTAATGAGAAATCAGTCAGCCTTCATGTCAGTTCAAACCGCACAGAGCGGCTCACGCAGCCTCCGCC

Function

NR:

description
PREDICTED: protein RCC2 homolog

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU494041 True 232 lncRNA 0.45 1 212122 212353

Neighbor

gene id symbol gene type direction distance location
CI01000306_00135679_00139917 NA coding upstream 71668 135500 ~ 140454 (+)
CI01000306_00107710_00118177 NA coding upstream 93162 106737 ~ 118960 (+)
CI01000306_00044391_00064128 NA coding upstream 147970 43677 ~ 64152 (+)
CI01000306_00235686_00242814 NA coding downstream 23094 235447 ~ 242861 (+)
CI01000306_00245734_00262949 LOXL4 coding downstream 32788 245141 ~ 263251 (+)
CI01000306_00279658_00285330 ERO1B coding downstream 67305 279658 ~ 285494 (+)
CI01000306_00285981_00288513 NA coding downstream 73476 285829 ~ 288715 (+)
CI01000306_00297906_00319127 NA coding downstream 85553 297906 ~ 319419 (+)
G430245 NA non-coding upstream 45747 155063 ~ 166375 (+)
G430269 NA non-coding downstream 979 213332 ~ 213645 (+)
G430270 NA non-coding downstream 1708 214061 ~ 214314 (+)
G430271 NA non-coding downstream 5236 217589 ~ 217842 (+)
G430272 NA non-coding downstream 5534 217887 ~ 229552 (+)
G430283 NA non-coding downstream 18466 230819 ~ 231095 (+)
G430409 NA other downstream 713191 925544 ~ 999902 (+)
G430452 NA other downstream 938244 1150597 ~ 1150938 (+)
CI01000306_01209847_01210850 ACYP2 other downstream 997380 1209395 ~ 1211232 (+)
G430719 NA other downstream 1936029 2148382 ~ 2150954 (+)

Expression


Co-expression Network