G430297


Basic Information

Item Value
gene id G430297
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 268242 ~ 268866 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU494074
TGCACAGTCTGGCCTTGAGTGTGACTTCTGCAAAGCCTCGAGTCCATCCTCTGGAACATGCTCACAATTTATCCTGAGTTCACTCAGACTCGGGCAGTTTTCACTGAGAGAGATGATTTGACTAATGCAATGCTTAGTCAGATTGTACACACTCAGTTCCATCTTTTTCAATCCAGGCAAAGATTGGAGGGAGAGCAGTGGCATATCTTCGGTCCAGTCTTTAATTTCTGTCCAAGTTTGAATTTCTCGAAAGATGTTTGTCCAGTCAAAGTTAATTATACTGGATTGTAGAAACGTGAGGGTGAATTCAGGCATAACGGTTCTGTTTGTATGAATATG

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU494074 True 339 lncRNA 0.42 2 268242 268866

Neighbor

gene id symbol gene type direction distance location
CI01000306_00245734_00262949 LOXL4 coding upstream 4991 245141 ~ 263251 (+)
CI01000306_00235686_00242814 NA coding upstream 25381 235447 ~ 242861 (+)
CI01000306_00135679_00139917 NA coding upstream 127788 135500 ~ 140454 (+)
CI01000306_00107710_00118177 NA coding upstream 149282 106737 ~ 118960 (+)
CI01000306_00044391_00064128 NA coding upstream 204090 43677 ~ 64152 (+)
CI01000306_00279658_00285330 ERO1B coding downstream 10792 279658 ~ 285494 (+)
CI01000306_00285981_00288513 NA coding downstream 16963 285829 ~ 288715 (+)
CI01000306_00297906_00319127 NA coding downstream 29040 297906 ~ 319419 (+)
CI01000306_00327727_00330881 NA coding downstream 58861 327727 ~ 330932 (+)
CI01000306_00344942_00353683 NA coding downstream 75681 344547 ~ 354116 (+)
G430283 NA non-coding upstream 37147 230819 ~ 231095 (+)
G430272 NA non-coding upstream 38690 217887 ~ 229552 (+)
G430271 NA non-coding upstream 50400 217589 ~ 217842 (+)
G430270 NA non-coding upstream 53928 214061 ~ 214314 (+)
G430269 NA non-coding upstream 54597 213332 ~ 213645 (+)
G430303 NA non-coding downstream 148942 417808 ~ 418042 (+)
G430067 NA non-coding downstream 180178 449044 ~ 483614 (+)
G430309 NA non-coding downstream 238566 507432 ~ 507773 (+)
G430310 NA non-coding downstream 255197 524063 ~ 524288 (+)
G430409 NA other downstream 656678 925544 ~ 999902 (+)
G430452 NA other downstream 881731 1150597 ~ 1150938 (+)
CI01000306_01209847_01210850 ACYP2 other downstream 940867 1209395 ~ 1211232 (+)
G430719 NA other downstream 1879516 2148382 ~ 2150954 (+)
CI01000306_02974291_02976718 TP53INP2 other downstream 2704290 2973156 ~ 2979157 (+)

Expression


Co-expression Network