G431546


Basic Information

Item Value
gene id G431546
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 403217 ~ 403559 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU495476
TTTCACAGCATTATATTTGACATTATGCTTTATTGTAAAATATGTTAAATCAGTTAAATTATTTTATAAATCTCTAAAATTCTCTGTAATTTTTCCTTTAAAATTTGCTGGTTCAGGTCAAACTCAAGCATGTTGGTTTTTGAAATGTTTGCGATCATTTCCAGACTTCAGAACTGAATTAAACTGATTAATTGAGGAACTTTGCACTATTTACACAGTTATTGAACTAAATTGAATCAACACTAAAGTGAATTGATCTGAATAATGACACTATTGTCTTTACAGTAGAATTGAACTCTGTTTGCATCATTGAATCTACTTTCCTGTTGATCACTGTGAAGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU495476 True 343 lncRNA 0.29 1 403217 403559

Neighbor

gene id symbol gene type direction distance location
CI01000306_00373354_00379937 NA coding downstream 23040 373283 ~ 380177 (-)
CI01000306_00331605_00336103 TOMM20 coding downstream 67114 331329 ~ 336103 (-)
CI01000306_00321852_00325373 NA coding downstream 77844 321539 ~ 325373 (-)
CI01000306_00291753_00295570 GPR137B coding downstream 107647 291344 ~ 295570 (-)
CI01000306_00264107_00273791 NA coding downstream 129426 263877 ~ 273791 (-)
CI01000306_00421158_00422795 NA coding upstream 17457 421016 ~ 423254 (-)
CI01000306_00466878_00474566 NA coding upstream 63154 466713 ~ 474566 (-)
CI01000306_00474870_00478789 BRAFLDRAFT_123431, GM5580, IF4A3, GM8994, EIF4A3.L, EIF4A3 coding upstream 71205 474764 ~ 478915 (-)
CI01000306_00482506_00494090 PFKLB, PFKL coding upstream 78923 482482 ~ 494090 (-)
CI01000306_00498705_00504548 ORC2 coding upstream 94925 498484 ~ 504548 (-)
G431505 NA non-coding downstream 217647 184011 ~ 185570 (-)
G431550 NA non-coding upstream 5898 409457 ~ 409722 (-)
G431551 NA non-coding upstream 6869 410428 ~ 410715 (-)
G431556 NA non-coding upstream 14238 417797 ~ 418042 (-)
G431568 NA non-coding upstream 117401 520960 ~ 521551 (-)
G431475 NA non-coding upstream 256485 660044 ~ 661145 (-)
G431706 NA other upstream 759468 1163027 ~ 1163338 (-)
G431814 NA other upstream 908143 1311702 ~ 1312434 (-)
CI01000306_01723684_01726043 MAFGA, MAFGB, MAFG other upstream 1314374 1717933 ~ 1726043 (-)
G432022 NA other upstream 2596677 3000236 ~ 3003891 (-)

Expression


Co-expression Network