G431576



Basic Information


Item Value
gene id G431576
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 699919 ~ 700243 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU495509
CTCTCATGTGATGTGTGGAGAGATGGAGGTGATTTTTCACCAAAATGTCAACAAATATCAGTTTTCACAAAAATGTTTTAATATTTGTGCACGTGGCTCTAATTTATTTGTTTAAAGCAAGCATGTTTATGACGATATTGCTTAAGAACGAATATTTTAAAATGCTTAATAAACCAAATTTACATGCAGTGAGGTTCAAAGGTCAGACACTAGTAAAAAAGCTTTTTTCGCATTGAATGGCATTTTTCTAATTTAATGCATTTTTTTTTACATTTTTCATGTAGCGCAAACTTGATTACAGTCACTGGAGAATATTTTTCTTACA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU495509 True 325 lncRNA 0.30 1 699919 700243

Neighbor


gene id symbol gene type direction distance location
CI01000306_00646585_00650863 GNB4, GNB1, GNB2, OL-GB1, GNB1A, GNB1B coding downstream 49056 646572 ~ 650863 (-)
CI01000306_00602711_00614050 NA coding downstream 85517 602691 ~ 614402 (-)
CI01000306_00588975_00600403 NA coding downstream 98573 588962 ~ 601346 (-)
CI01000306_00575882_00583996 SYNGR2B coding downstream 115481 575693 ~ 584438 (-)
CI01000306_00566977_00570868 NA coding downstream 128884 566977 ~ 571035 (-)
CI01000306_00701052_00701714 NA coding upstream 694 700937 ~ 701714 (-)
CI01000306_00717778_00722360 NA coding upstream 17376 717619 ~ 722360 (-)
CI01000306_00815374_00840697 NA coding upstream 114755 814998 ~ 840697 (-)
CI01000306_00879678_00883167 NA coding upstream 179260 879503 ~ 883182 (-)
CI01000306_00896923_00897303 NA coding upstream 196674 895082 ~ 898523 (-)
G431475 NA non-coding downstream 38774 660044 ~ 661145 (-)
G431568 NA non-coding downstream 178368 520960 ~ 521551 (-)
G431556 NA non-coding downstream 281877 417797 ~ 418042 (-)
G431551 NA non-coding downstream 289204 410428 ~ 410715 (-)
G431550 NA non-coding downstream 290197 409457 ~ 409722 (-)
G431486 NA non-coding upstream 12664 712907 ~ 714529 (-)
G431618 NA non-coding upstream 83724 783967 ~ 785240 (-)
G431611 NA non-coding upstream 156885 857128 ~ 868493 (-)
G431639 NA non-coding upstream 207111 907354 ~ 946054 (-)
CI01000306_00482506_00494090 PFKLB, PFKL other downstream 216270 482482 ~ 494090 (-)
G431706 NA other upstream 462784 1163027 ~ 1163338 (-)
G431814 NA other upstream 611459 1311702 ~ 1312434 (-)
CI01000306_01723684_01726043 MAFGA, MAFGB, MAFG other upstream 1017690 1717933 ~ 1726043 (-)
G432022 NA other upstream 2299993 3000236 ~ 3003891 (-)
CI01000306_04544349_04545034 NA other upstream 3842480 4542723 ~ 4545244 (-)

Expression



Co-expression Network