G430335


Basic Information

Item Value
gene id G430335
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 729903 ~ 730241 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU494118
TAGCATTATTCTAACGTTGTTCTAACATTATTGTAATGTTCCCCTAAGGTTATTCTACCCTTATTCTAACTTTCCACTAAGGTTATTCTACCATTATTCTAACGTTGTTCTAACATTATTGTAACGTTCCCCTAAGGTTATTCTACCATTATTCTAGCGTTCCCCAAAGGTTATTCTATCATTATTCTAACGTTCCCCTAAGGTTATTCTAGCATTATTCTAACGTTGCTCTAACATTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU494118 True 240 lncRNA 0.33 2 729903 730241

Neighbor

gene id symbol gene type direction distance location
CI01000306_00705287_00711760 CLCN4 coding upstream 17318 705287 ~ 714524 (+)
CI01000306_00693218_00693943 NA coding upstream 35344 693218 ~ 694559 (+)
CI01000306_00681384_00689565 NA coding upstream 40091 681384 ~ 689812 (+)
CI01000306_00664788_00672147 NA coding upstream 56851 664721 ~ 673052 (+)
CI01000306_00630572_00641931 TMC6 coding upstream 87777 630572 ~ 642126 (+)
CI01000306_00730637_00781399 CLASP1 coding downstream 396 730637 ~ 781399 (+)
CI01000306_00887579_00889885 NA coding downstream 156949 887190 ~ 890708 (+)
CI01000306_01008614_01011977 RALB.S, RALBA, RALBB, RALB.L, RALB coding downstream 278373 1008614 ~ 1011977 (+)
CI01000306_01047698_01080329 TMEM63A, TMEM63B coding downstream 317457 1047698 ~ 1082259 (+)
CI01000306_01209847_01210850 ACYP2 coding downstream 479154 1209395 ~ 1211232 (+)
G430331 NA non-coding upstream 27709 701983 ~ 702194 (+)
G430075 NA non-coding upstream 82859 564976 ~ 647044 (+)
G430344 NA non-coding downstream 76276 806517 ~ 806752 (+)
G430389 NA non-coding downstream 177082 907323 ~ 913761 (+)
G430419 NA non-coding downstream 254274 984515 ~ 984938 (+)
G430400 NA non-coding downstream 272617 1002858 ~ 1026103 (+)
G430425 NA non-coding downstream 302979 1033220 ~ 1045108 (+)
CI01000306_00235686_00242814 NA other upstream 492534 235447 ~ 242861 (+)
G430409 NA other downstream 195303 925544 ~ 999902 (+)
G430452 NA other downstream 420356 1150597 ~ 1150938 (+)
G430719 NA other downstream 1418141 2148382 ~ 2150954 (+)
CI01000306_02974291_02976718 TP53INP2 other downstream 2242915 2973156 ~ 2979157 (+)

Expression


Co-expression Network