G430344


Basic Information

Item Value
gene id G430344
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 806517 ~ 806752 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU494127
AGTCAGATTTTAATATTATCTCAAATACTGCTATTCACATTCATTTTATAGCTCTGAGATATAAAAGACAAACCTCTTATGAGATACAGTCTGTGTAAAAGTTTCAGGACAAGGTTAGACATGATTCTTGGAGATGTCTTGTTATGTCCGCCCGTCTGTCCTTGTGTTTTGGTGTCTGGTGTTTGACGTGTCTTTACTGGTCTCGTCAGGGTTTGAGTTTCATGTTTCGGCTCATG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU494127 True 236 lncRNA 0.39 1 806517 806752

Neighbor

gene id symbol gene type direction distance location
CI01000306_00730637_00781399 CLASP1 coding upstream 25118 730637 ~ 781399 (+)
CI01000306_00705287_00711760 CLCN4 coding upstream 93932 705287 ~ 714524 (+)
CI01000306_00693218_00693943 NA coding upstream 111958 693218 ~ 694559 (+)
CI01000306_00681384_00689565 NA coding upstream 116705 681384 ~ 689812 (+)
CI01000306_00664788_00672147 NA coding upstream 133465 664721 ~ 673052 (+)
CI01000306_00887579_00889885 NA coding downstream 80438 887190 ~ 890708 (+)
CI01000306_01008614_01011977 RALB.S, RALBA, RALBB, RALB.L, RALB coding downstream 201862 1008614 ~ 1011977 (+)
CI01000306_01047698_01080329 TMEM63A, TMEM63B coding downstream 240946 1047698 ~ 1082259 (+)
CI01000306_01209847_01210850 ACYP2 coding downstream 402643 1209395 ~ 1211232 (+)
CI01000306_01224349_01255175 NA coding downstream 417398 1224150 ~ 1255472 (+)
G430335 NA non-coding upstream 76276 729903 ~ 730241 (+)
G430331 NA non-coding upstream 104323 701983 ~ 702194 (+)
G430170 NA non-coding upstream 193926 608747 ~ 612591 (+)
G430206 NA non-coding upstream 198226 605291 ~ 608291 (+)
G430389 NA non-coding downstream 100571 907323 ~ 913761 (+)
G430419 NA non-coding downstream 177763 984515 ~ 984938 (+)
G430400 NA non-coding downstream 196106 1002858 ~ 1026103 (+)
G430425 NA non-coding downstream 226468 1033220 ~ 1045108 (+)
G430433 NA non-coding downstream 263616 1070368 ~ 1071227 (+)
CI01000306_00235686_00242814 NA other upstream 569148 235447 ~ 242861 (+)
G430409 NA other downstream 118792 925544 ~ 999902 (+)
G430452 NA other downstream 343845 1150597 ~ 1150938 (+)
G430719 NA other downstream 1341630 2148382 ~ 2150954 (+)
CI01000306_02974291_02976718 TP53INP2 other downstream 2166404 2973156 ~ 2979157 (+)

Expression


Co-expression Network