G430433


Basic Information

Item Value
gene id G430433
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 1070368 ~ 1071227 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU494230
ATTTTGGGTTCATAATAAGCAAGAAATACAGTAATTTTTAAACAACCCATTCGCTGGGTTAAAACAGCCCAATCACTGGGTTAAAACAACCCAATCGCTGGGTTAAAACAGCCCAATCGCTGGGTTAAAACAGCCCAATCCCTGGGTTAAAACAACCCATTCCCTGGGTTAAAACAGCCCATTCCCTGGGTTAAAACAGCCCAATCCCTGGGTTAAAACAGCCCAATCGCTGGGTTAAAACACCCCAATCGCTGGGTTAAAACACCCCAATCGCTGGGTTAAAACAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU494230 True 288 lncRNA 0.45 2 1070368 1071227

Neighbor

gene id symbol gene type direction distance location
CI01000306_01008614_01011977 RALB.S, RALBA, RALBB, RALB.L, RALB coding upstream 58391 1008614 ~ 1011977 (+)
CI01000306_00887579_00889885 NA coding upstream 179660 887190 ~ 890708 (+)
CI01000306_00730637_00781399 CLASP1 coding upstream 288969 730637 ~ 781399 (+)
CI01000306_00705287_00711760 CLCN4 coding upstream 357783 705287 ~ 714524 (+)
CI01000306_00693218_00693943 NA coding upstream 375809 693218 ~ 694559 (+)
CI01000306_01209847_01210850 ACYP2 coding downstream 138168 1209395 ~ 1211232 (+)
CI01000306_01224349_01255175 NA coding downstream 152923 1224150 ~ 1255472 (+)
CI01000306_01278230_01279369 NA coding downstream 207003 1278230 ~ 1279484 (+)
CI01000306_01293889_01308316 SPTBN1 coding downstream 222441 1293668 ~ 1308316 (+)
CI01000306_01308428_01312462 SPTBN1 coding downstream 237201 1308428 ~ 1312870 (+)
G430425 NA non-coding upstream 25260 1033220 ~ 1045108 (+)
G430400 NA non-coding upstream 44265 1002858 ~ 1026103 (+)
G430419 NA non-coding upstream 85430 984515 ~ 984938 (+)
G430389 NA non-coding upstream 156607 907323 ~ 913761 (+)
G430344 NA non-coding upstream 263616 806517 ~ 806752 (+)
G430397 NA non-coding downstream 11301 1082528 ~ 1084265 (+)
G430434 NA non-coding downstream 24044 1095271 ~ 1095590 (+)
G430407 NA non-coding downstream 45591 1116818 ~ 1119768 (+)
G430460 NA non-coding downstream 89755 1160982 ~ 1161492 (+)
G430462 NA non-coding downstream 91784 1163011 ~ 1163473 (+)
G430409 NA other upstream 70466 925544 ~ 999902 (+)
CI01000306_00235686_00242814 NA other upstream 832999 235447 ~ 242861 (+)
G430452 NA other downstream 79370 1150597 ~ 1150938 (+)
G430719 NA other downstream 1077155 2148382 ~ 2150954 (+)
CI01000306_02974291_02976718 TP53INP2 other downstream 1901929 2973156 ~ 2979157 (+)
CI01000306_03772689_03777211 DYNLRB1 other downstream 2702917 3772689 ~ 3777550 (+)

Expression


Co-expression Network