G430434


Basic Information

Item Value
gene id G430434
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 1095271 ~ 1095590 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU494231
TGTGCGCAAAAACAAACAAAAATAACGACTTTACTCAACAATGTCTTCTGTGTCATTCTCATACGTTGTTTACATCCAACGCTTCCAGGTTCTACGCCAGAACGCTATTGGCCGGCTCCTGTGTCAGCATCACACACATGCGTCGTGCTGATCATGTGATTAGCTTTGGCCAATACTGAGCTGGTATTCGGACGTAAACACGGAAGCCTTCACTGCATCACCTGCGTAAGGATAATGACAGGGAAGAGAAGAGATTGTTGAATAAAGTTGTTATTTTTGTTTGTTTTTGCGCACAAAAAGTATTCTCGTCTCTTCATAAC

Function

NR:

description
Transposable element Tcb1 transposase

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU494231 True 320 lncRNA 0.43 1 1095271 1095590

Neighbor

gene id symbol gene type direction distance location
CI01000306_01047698_01080329 TMEM63A, TMEM63B coding upstream 13012 1047698 ~ 1082259 (+)
CI01000306_01008614_01011977 RALB.S, RALBA, RALBB, RALB.L, RALB coding upstream 83294 1008614 ~ 1011977 (+)
CI01000306_00887579_00889885 NA coding upstream 204563 887190 ~ 890708 (+)
CI01000306_00730637_00781399 CLASP1 coding upstream 313872 730637 ~ 781399 (+)
CI01000306_00705287_00711760 CLCN4 coding upstream 382686 705287 ~ 714524 (+)
CI01000306_01209847_01210850 ACYP2 coding downstream 113805 1209395 ~ 1211232 (+)
CI01000306_01224349_01255175 NA coding downstream 128560 1224150 ~ 1255472 (+)
CI01000306_01278230_01279369 NA coding downstream 182640 1278230 ~ 1279484 (+)
CI01000306_01293889_01308316 SPTBN1 coding downstream 198078 1293668 ~ 1308316 (+)
CI01000306_01308428_01312462 SPTBN1 coding downstream 212838 1308428 ~ 1312870 (+)
G430397 NA non-coding upstream 11006 1082528 ~ 1084265 (+)
G430433 NA non-coding upstream 24044 1070368 ~ 1071227 (+)
G430425 NA non-coding upstream 50163 1033220 ~ 1045108 (+)
G430400 NA non-coding upstream 69168 1002858 ~ 1026103 (+)
G430419 NA non-coding upstream 110333 984515 ~ 984938 (+)
G430407 NA non-coding downstream 21228 1116818 ~ 1119768 (+)
G430460 NA non-coding downstream 65392 1160982 ~ 1161492 (+)
G430462 NA non-coding downstream 67421 1163011 ~ 1163473 (+)
G430467 NA non-coding downstream 72422 1168012 ~ 1168563 (+)
G430470 NA non-coding downstream 78096 1173686 ~ 1173906 (+)
G430409 NA other upstream 95369 925544 ~ 999902 (+)
CI01000306_00235686_00242814 NA other upstream 857902 235447 ~ 242861 (+)
G430452 NA other downstream 55007 1150597 ~ 1150938 (+)
G430719 NA other downstream 1052792 2148382 ~ 2150954 (+)
CI01000306_02974291_02976718 TP53INP2 other downstream 1877566 2973156 ~ 2979157 (+)
CI01000306_03772689_03777211 DYNLRB1 other downstream 2678554 3772689 ~ 3777550 (+)

Expression


Co-expression Network