G430470


Basic Information

Item Value
gene id G430470
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 1173686 ~ 1173906 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU494272
AAATAATATGATTCTGGTGTCTCTTGGATCTGAGTGCAGCTTTTAATACTGTTTTAATCTCATCTAGCTGCTGTCAGTATCACTGGTACTGTCTTTCCATGGCTTCATATCTCTTGGACAGGCAACAATTCATTAGCATTAATAAACAGAAATCTCGCTCTGTCACTGTTTCCAGTGGTGTACCTCAAGGGTCCGTTCTCAGTCCGCTTCTGTTTCTAATC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU494272 True 221 lncRNA 0.41 1 1173686 1173906

Neighbor

gene id symbol gene type direction distance location
CI01000306_01047698_01080329 TMEM63A, TMEM63B coding upstream 91427 1047698 ~ 1082259 (+)
CI01000306_01008614_01011977 RALB.S, RALBA, RALBB, RALB.L, RALB coding upstream 161709 1008614 ~ 1011977 (+)
CI01000306_00887579_00889885 NA coding upstream 282978 887190 ~ 890708 (+)
CI01000306_00730637_00781399 CLASP1 coding upstream 392287 730637 ~ 781399 (+)
CI01000306_00705287_00711760 CLCN4 coding upstream 461101 705287 ~ 714524 (+)
CI01000306_01209847_01210850 ACYP2 coding downstream 35489 1209395 ~ 1211232 (+)
CI01000306_01224349_01255175 NA coding downstream 50244 1224150 ~ 1255472 (+)
CI01000306_01278230_01279369 NA coding downstream 104324 1278230 ~ 1279484 (+)
CI01000306_01293889_01308316 SPTBN1 coding downstream 119762 1293668 ~ 1308316 (+)
CI01000306_01308428_01312462 SPTBN1 coding downstream 134522 1308428 ~ 1312870 (+)
G430467 NA non-coding upstream 5123 1168012 ~ 1168563 (+)
G430462 NA non-coding upstream 10213 1163011 ~ 1163473 (+)
G430460 NA non-coding upstream 12194 1160982 ~ 1161492 (+)
G430407 NA non-coding upstream 53918 1116818 ~ 1119768 (+)
G430434 NA non-coding upstream 78096 1095271 ~ 1095590 (+)
G430477 NA non-coding downstream 18611 1192517 ~ 1192719 (+)
G430478 NA non-coding downstream 19842 1193748 ~ 1193960 (+)
G430113 NA non-coding downstream 62439 1236345 ~ 1270115 (+)
G430142 NA non-coding downstream 110784 1284690 ~ 1286761 (+)
G430182 NA non-coding downstream 114819 1288725 ~ 1289910 (+)
G430452 NA other upstream 22748 1150597 ~ 1150938 (+)
G430409 NA other upstream 173784 925544 ~ 999902 (+)
CI01000306_00235686_00242814 NA other upstream 936317 235447 ~ 242861 (+)
G430719 NA other downstream 974476 2148382 ~ 2150954 (+)
CI01000306_02974291_02976718 TP53INP2 other downstream 1799250 2973156 ~ 2979157 (+)
CI01000306_03772689_03777211 DYNLRB1 other downstream 2600238 3772689 ~ 3777550 (+)
CI01000306_03778075_03781910 MAP1LC3A, MAP1LC3A.L other downstream 2604146 3778052 ~ 3783019 (+)

Expression


Co-expression Network