G431852


Basic Information

Item Value
gene id G431852
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 1286584 ~ 1286787 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU495871
GGCAGCTTGAATATAATAGCTATATAATACTCTGCTGTTAACACTTACAGGGAGCTAGATGGAAAATGGGATTTAATATATTTTGAGAGCAATGGCAAAGTCAACTGAATGACAACCTACATTTGCCTTTGAGCGTCTCTAAGCATGTTCAGATAAATCAATACTGGAGTCTGGATTGTTGATCAGGTCAAGAGGTCAAATTAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU495871 True 204 lncRNA 0.37 1 1286584 1286787

Neighbor

gene id symbol gene type direction distance location
CI01000306_01201604_01202608 FOXG1B coding downstream 82511 1200682 ~ 1204073 (-)
CI01000306_01120958_01127237 SULT6B1 coding downstream 159024 1120816 ~ 1127560 (-)
CI01000306_01109880_01112379 VIPB coding downstream 173781 1109779 ~ 1112803 (-)
CI01000306_01086915_01093095 SLC29A1B coding downstream 193483 1086768 ~ 1093101 (-)
CI01000306_01024523_01027114 NA coding downstream 259453 1024340 ~ 1027131 (-)
CI01000306_01439864_01463150 NA coding upstream 152999 1439786 ~ 1463150 (-)
CI01000306_01469486_01475137 NA coding upstream 182001 1468788 ~ 1475137 (-)
CI01000306_01476783_01478195 NA coding upstream 189877 1476664 ~ 1478195 (-)
CI01000306_01483485_01492511 ATL2, ATL2.L coding upstream 196085 1482872 ~ 1492511 (-)
CI01000306_01502721_01504240 NA coding upstream 215879 1502666 ~ 1504240 (-)
CI01000306_01284891_01287606 NA non-coding downstream 1658 1284677 ~ 1287630 (-)
G431849 NA non-coding downstream 6514 1279518 ~ 1280070 (-)
G431823 NA non-coding downstream 7898 1236441 ~ 1278686 (-)
G431818 NA non-coding downstream 24996 1247340 ~ 1261588 (-)
G431810 NA non-coding downstream 64224 1221861 ~ 1222360 (-)
G431853 NA non-coding upstream 3163 1289950 ~ 1290345 (-)
G431815 NA non-coding upstream 21244 1308031 ~ 1310878 (-)
G431814 NA non-coding upstream 24915 1311702 ~ 1312434 (-)
G431855 NA non-coding upstream 36387 1323174 ~ 1323386 (-)
G431857 NA non-coding upstream 37554 1324341 ~ 1324541 (-)
G431706 NA other downstream 123246 1163027 ~ 1163338 (-)
CI01000306_00482506_00494090 PFKLB, PFKL other downstream 802935 482482 ~ 494090 (-)
CI01000306_01723684_01726043 MAFGA, MAFGB, MAFG other upstream 431146 1717933 ~ 1726043 (-)
G432022 NA other upstream 1713449 3000236 ~ 3003891 (-)
CI01000306_04544349_04545034 NA other upstream 3255936 4542723 ~ 4545244 (-)
G433450 NA other upstream 4074856 5361643 ~ 5383763 (-)

Expression


Co-expression Network