G430499


Basic Information

Item Value
gene id G430499
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 1399618 ~ 1399833 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU494303
TGACAGGTTGCCCCGCCCTCGTCATCAGAGAAGAGATGTCGCTGCGAGAGGGAGGGGAAGTTATTTTGATTAAAGATCTCTTAAGGCACATGAATTAAAAAAAATTGTTGATTTGCATGGATAAATCTTTTATAATAAACAAACAAACAAAAATGTCGATTTTGATTTCATGGTGACTTTAAGAACAGCACAGATCCTGTACCGTGAGCGTTTGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU494303 True 216 lncRNA 0.38 1 1399618 1399833

Neighbor

gene id symbol gene type direction distance location
CI01000306_01387861_01391135 NA coding upstream 7297 1387602 ~ 1392321 (+)
CI01000306_01329678_01378388 EML6, EML5 coding upstream 21108 1329678 ~ 1378510 (+)
CI01000306_01315927_01321358 NA coding upstream 77324 1315532 ~ 1322294 (+)
CI01000306_01308428_01312462 SPTBN1 coding upstream 86748 1308428 ~ 1312870 (+)
CI01000306_01293889_01308316 SPTBN1 coding upstream 91302 1293668 ~ 1308316 (+)
CI01000306_01429843_01430151 NA coding downstream 28980 1427779 ~ 1430275 (+)
CI01000306_01481595_01481955 NA coding downstream 81762 1481595 ~ 1482496 (+)
CI01000306_01578460_01578838 NA coding downstream 178627 1578460 ~ 1579027 (+)
CI01000306_01627469_01632656 RFC4 coding downstream 227636 1627469 ~ 1632729 (+)
CI01000306_01639496_01661857 ANKRD13C.S, ANKRD13C, ANKRD13C.L coding downstream 239232 1639065 ~ 1663148 (+)
G430498 NA non-coding upstream 2441 1396913 ~ 1397177 (+)
G430497 NA non-coding upstream 3648 1395752 ~ 1395970 (+)
G430492 NA non-coding upstream 14767 1384634 ~ 1384851 (+)
G430489 NA non-coding upstream 75190 1323063 ~ 1324428 (+)
G430182 NA non-coding upstream 109708 1288725 ~ 1289910 (+)
G430502 NA non-coding downstream 7197 1407030 ~ 1407249 (+)
G430504 NA non-coding downstream 8497 1408330 ~ 1408560 (+)
G430509 NA non-coding downstream 15374 1415207 ~ 1415606 (+)
G430515 NA non-coding downstream 31256 1431089 ~ 1431487 (+)
CI01000306_01209847_01210850 ACYP2 other upstream 181061 1209395 ~ 1211232 (+)
G430452 NA other upstream 248680 1150597 ~ 1150938 (+)
G430409 NA other upstream 399716 925544 ~ 999902 (+)
CI01000306_00235686_00242814 NA other upstream 1162249 235447 ~ 242861 (+)
G430719 NA other downstream 748549 2148382 ~ 2150954 (+)
CI01000306_02974291_02976718 TP53INP2 other downstream 1573323 2973156 ~ 2979157 (+)
CI01000306_03772689_03777211 DYNLRB1 other downstream 2374311 3772689 ~ 3777550 (+)
CI01000306_03778075_03781910 MAP1LC3A, MAP1LC3A.L other downstream 2378219 3778052 ~ 3783019 (+)
CI01000306_03807268_03810946 NA other downstream 2408400 3807268 ~ 3811243 (+)

Expression


Co-expression Network