G430533


Basic Information

Item Value
gene id G430533
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 1503389 ~ 1503601 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU494343
GTCACGATCACCGTCTGTTCCTGTCAGTTCCTGGACTCCATTTCCCATAATCCTCCCTGCCAATCACATGCACACTCCACACCAATCACCAATTGCCACACACACCTGTAGATCATTACCTGGACTATAAAAGACTCACACACACACCACCTCATTGCGAAGTCTTGTTTCACCTAGTGTACATTTCTGAGCGTTATTATCCTGTCTACCTGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU494343 True 213 lncRNA 0.46 1 1503389 1503601

Neighbor

gene id symbol gene type direction distance location
CI01000306_01481595_01481955 NA coding upstream 20893 1481595 ~ 1482496 (+)
CI01000306_01429843_01430151 NA coding upstream 73114 1427779 ~ 1430275 (+)
CI01000306_01387861_01391135 NA coding upstream 111068 1387602 ~ 1392321 (+)
CI01000306_01329678_01378388 EML6, EML5 coding upstream 124879 1329678 ~ 1378510 (+)
CI01000306_01315927_01321358 NA coding upstream 181095 1315532 ~ 1322294 (+)
CI01000306_01578460_01578838 NA coding downstream 74859 1578460 ~ 1579027 (+)
CI01000306_01627469_01632656 RFC4 coding downstream 123868 1627469 ~ 1632729 (+)
CI01000306_01639496_01661857 ANKRD13C.S, ANKRD13C, ANKRD13C.L coding downstream 135464 1639065 ~ 1663148 (+)
CI01000306_01679537_01704400 NA coding downstream 175936 1679537 ~ 1704951 (+)
CI01000306_01811531_01821737 NA coding downstream 307930 1811531 ~ 1821864 (+)
G430161 NA non-coding upstream 63416 1437095 ~ 1439973 (+)
G430515 NA non-coding upstream 71902 1431089 ~ 1431487 (+)
G430509 NA non-coding upstream 87783 1415207 ~ 1415606 (+)
G430504 NA non-coding upstream 94829 1408330 ~ 1408560 (+)
G430534 NA non-coding downstream 3028 1506629 ~ 1506862 (+)
G430133 NA non-coding downstream 25551 1529152 ~ 1531757 (+)
G430549 NA non-coding downstream 89552 1593153 ~ 1593740 (+)
G430554 NA non-coding downstream 113473 1617074 ~ 1617414 (+)
G430555 NA non-coding downstream 114137 1617738 ~ 1617989 (+)
CI01000306_01209847_01210850 ACYP2 other upstream 284832 1209395 ~ 1211232 (+)
G430452 NA other upstream 352451 1150597 ~ 1150938 (+)
G430409 NA other upstream 503487 925544 ~ 999902 (+)
CI01000306_00235686_00242814 NA other upstream 1266020 235447 ~ 242861 (+)
G430719 NA other downstream 644781 2148382 ~ 2150954 (+)
CI01000306_02974291_02976718 TP53INP2 other downstream 1469555 2973156 ~ 2979157 (+)
CI01000306_03772689_03777211 DYNLRB1 other downstream 2270543 3772689 ~ 3777550 (+)
CI01000306_03778075_03781910 MAP1LC3A, MAP1LC3A.L other downstream 2274451 3778052 ~ 3783019 (+)
CI01000306_03807268_03810946 NA other downstream 2304632 3807268 ~ 3811243 (+)

Expression


Co-expression Network