G430805


Basic Information

Item Value
gene id G430805
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 2352711 ~ 2352939 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU494645
CACTCATGCAACCCCATACCATCAGAGATGCAGGCTTCTGAACTGAGCGCTGATAACAACTTGGGTTGTCCTTGTCCTCTTTAGTCCGGATGACATGGCGTCCCAGTTTTCCAAAAAGAACTTCAAATTTTGATTCGTCTGACCACAGAACTGTTTTCCACTTTGCCACAGTCCATTTTAAATGAGCCTTGGCCCAGAGAAAACGCCTGCGCTTCTGGATCATGTTTAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU494645 True 229 lncRNA 0.46 1 2352711 2352939

Neighbor

gene id symbol gene type direction distance location
CI01000306_02263738_02279937 NA coding upstream 72699 2263618 ~ 2280012 (+)
CI01000306_02238316_02241601 MAF1 coding upstream 110311 2238316 ~ 2242400 (+)
CI01000306_02230144_02236022 ZC3H11A coding upstream 115729 2230144 ~ 2236982 (+)
CI01000306_02204158_02222866 IL17RD coding upstream 129845 2203927 ~ 2222866 (+)
CI01000306_02183898_02186529 NA coding upstream 165935 2183898 ~ 2186776 (+)
CI01000306_02354432_02358965 PNP4A coding downstream 242 2353181 ~ 2359501 (+)
CI01000306_02359989_02366944 NA coding downstream 7050 2359989 ~ 2366997 (+)
CI01000306_02369579_02380912 REM1, GEM coding downstream 16640 2369579 ~ 2381322 (+)
CI01000306_02389329_02392416 RBM39, RBM39A, RBM39B coding downstream 36390 2389329 ~ 2392960 (+)
CI01000306_02398383_02404841 NFS1 coding downstream 44928 2397867 ~ 2404903 (+)
G430745 NA non-coding upstream 67425 2270777 ~ 2285286 (+)
G430739 NA non-coding upstream 160330 2159462 ~ 2192381 (+)
CI01000306_02112910_02114040 ARF4B non-coding upstream 238609 2112815 ~ 2114420 (+)
G430632 NA non-coding upstream 323419 2003702 ~ 2029292 (+)
G430611 NA non-coding upstream 362962 1935585 ~ 1989749 (+)
G430811 NA non-coding downstream 33345 2386284 ~ 2386558 (+)
G430834 NA non-coding downstream 129167 2482106 ~ 2483041 (+)
G430931 NA non-coding downstream 530952 2883891 ~ 3238771 (+)
G430690 NA non-coding downstream 683129 3036068 ~ 3054700 (+)
G430951 NA non-coding downstream 696958 3049897 ~ 3050294 (+)
G430719 NA other upstream 201757 2148382 ~ 2150954 (+)
CI01000306_01209847_01210850 ACYP2 other upstream 1134154 1209395 ~ 1211232 (+)
G430452 NA other upstream 1201773 1150597 ~ 1150938 (+)
G430409 NA other upstream 1352809 925544 ~ 999902 (+)
CI01000306_00235686_00242814 NA other upstream 2115342 235447 ~ 242861 (+)
CI01000306_02974291_02976718 TP53INP2 other downstream 620217 2973156 ~ 2979157 (+)
CI01000306_03772689_03777211 DYNLRB1 other downstream 1421205 3772689 ~ 3777550 (+)
CI01000306_03778075_03781910 MAP1LC3A, MAP1LC3A.L other downstream 1425113 3778052 ~ 3783019 (+)
CI01000306_03807268_03810946 NA other downstream 1455294 3807268 ~ 3811243 (+)
G432583 NA other downstream 1973463 4326402 ~ 4327822 (+)

Expression


Co-expression Network