G432285


Basic Information

Item Value
gene id G432285
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 3137285 ~ 3137732 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU496377
TGGAAGTCTGGAATTCCATAATGATCCATAACTGTTTTTTATTGCAGCGCCTCAATATGGCTTCAACAGGTGGAATTGGGTCCACCAGCTGCTCAATCTTCACACAGTTCCGAAGGATCATGGCAGCATCGCTGGTTGAGGTTGCCATTACAATACCAGGGCAATCTAAAAGTTTGATATGTTTGTCTAGATGGACCTCCTGTAAACACTTAGTAACTCCAGGTGTAGCTCCAACATTACATGCACGAGCACGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU496377 True 255 lncRNA 0.45 3 3137285 3137732

Neighbor

gene id symbol gene type direction distance location
CI01000306_03086600_03106758 HCFC1B, HCFC1A, HCFC1 coding downstream 29070 3086510 ~ 3108215 (-)
CI01000306_03070842_03073585 GATA1A coding downstream 63651 3070578 ~ 3073634 (-)
CI01000306_03044394_03045362 NA coding downstream 91080 3043376 ~ 3046205 (-)
CI01000306_03006241_03009198 NA coding downstream 127929 3006190 ~ 3009356 (-)
CI01000306_02966994_02968675 SNAI1A coding downstream 168099 2965937 ~ 2969186 (-)
CI01000306_03258305_03268722 BRPF3A coding upstream 119491 3257223 ~ 3268722 (-)
CI01000306_03278833_03292888 PLCH2B coding upstream 141101 3278833 ~ 3292888 (-)
CI01000306_03296768_03330783 SKIA, SKIB, SKI coding upstream 157991 3295723 ~ 3330783 (-)
CI01000306_03334185_03336292 NA coding upstream 196100 3333832 ~ 3336292 (-)
CI01000306_03357647_03435533 KAZN, KAZNB coding upstream 219915 3357647 ~ 3435533 (-)
G432280 NA non-coding downstream 11331 3123477 ~ 3125954 (-)
G432051 NA non-coding downstream 180941 2952249 ~ 2956344 (-)
G432032 NA non-coding downstream 255552 2876373 ~ 2881733 (-)
G432196 NA non-coding downstream 378526 2758459 ~ 2758759 (-)
G432173 NA non-coding downstream 393434 2743133 ~ 2743851 (-)
G432282 NA non-coding upstream 1059 3138791 ~ 3139881 (-)
G432281 NA non-coding upstream 11208 3148940 ~ 3152959 (-)
G432308 NA non-coding upstream 93779 3231511 ~ 3277198 (-)
G432370 NA non-coding upstream 146767 3284499 ~ 3284782 (-)
G432022 NA other downstream 133394 3000236 ~ 3003891 (-)
CI01000306_01723684_01726043 MAFGA, MAFGB, MAFG other downstream 1388335 1717933 ~ 1726043 (-)
G431814 NA other downstream 1824851 1311702 ~ 1312434 (-)
G431706 NA other downstream 1973947 1163027 ~ 1163338 (-)
CI01000306_00482506_00494090 PFKLB, PFKL other downstream 2653636 482482 ~ 494090 (-)
CI01000306_04544349_04545034 NA other upstream 1404991 4542723 ~ 4545244 (-)
G433450 NA other upstream 2223911 5361643 ~ 5383763 (-)
G433670 NA other upstream 2903282 6041014 ~ 6041283 (-)
G433985 NA other upstream 3058375 6196107 ~ 6197210 (-)
G434016 NA other upstream 3217448 6355180 ~ 6361643 (-)

Expression


Co-expression Network