G430987


Basic Information

Item Value
gene id G430987
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 3280731 ~ 3280990 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU494841
CAAAGACATCTGTCTGGCATTTATTTAAATGAAAAATATAAATAAATTGTGTTACGGGTGAATAATGACGTCCTGTTTCCATCAGTGTCAGTCACTAAAAACACATATGAATCAACCACTAACCTTATAAATGACATTATATTTGAATTATCAGTACTGCCAAATTTGGTTTGCACAATCTAGATTTGTACTTACCATTGTCATCTACTACTCTTGTCTGCTGTTTATTACAATCAATAGGCAATCCAATTATCTCCACT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU494841 True 260 lncRNA 0.32 1 3280731 3280990

Neighbor

gene id symbol gene type direction distance location
CI01000306_03270390_03277409 NA coding upstream 3175 3270390 ~ 3277556 (+)
CI01000306_03248839_03256675 MON1BB, MON1B coding upstream 23668 3248839 ~ 3257063 (+)
CI01000306_03244498_03247567 OTUD5B, OTUD5, OTUD5A coding upstream 32903 3242896 ~ 3247828 (+)
CI01000306_03219408_03238461 GRM7, GRM6B coding upstream 42257 3219408 ~ 3238474 (+)
CI01000306_03214469_03216852 COMTB coding upstream 63851 3214469 ~ 3216880 (+)
CI01000306_03612105_03612431 NA coding downstream 330815 3611805 ~ 3612761 (+)
CI01000306_03642939_03646831 PPCS coding downstream 361949 3642939 ~ 3647153 (+)
CI01000306_03658929_03661523 RBM12 coding downstream 377650 3658640 ~ 3662015 (+)
CI01000306_03666143_03671601 NA coding downstream 385153 3666143 ~ 3672675 (+)
CI01000306_03677906_03697637 NA coding downstream 396916 3677906 ~ 3697792 (+)
G430931 NA non-coding upstream 41960 2883891 ~ 3238771 (+)
G430716 NA non-coding upstream 181372 3098644 ~ 3099359 (+)
CI01000306_03048314_03055936 NA non-coding upstream 224661 3048314 ~ 3056098 (+)
G430690 NA non-coding upstream 226031 3036068 ~ 3054700 (+)
G430951 NA non-coding upstream 230437 3049897 ~ 3050294 (+)
G431039 NA non-coding downstream 78787 3359777 ~ 3370252 (+)
G431107 NA non-coding downstream 206533 3487523 ~ 3488001 (+)
G431125 NA non-coding downstream 237064 3518054 ~ 3518312 (+)
G431129 NA non-coding downstream 250904 3531894 ~ 3532107 (+)
G431130 NA non-coding downstream 251614 3532604 ~ 3537455 (+)
CI01000306_02974291_02976718 TP53INP2 other upstream 301574 2973156 ~ 2979157 (+)
G430719 NA other upstream 1129777 2148382 ~ 2150954 (+)
CI01000306_01209847_01210850 ACYP2 other upstream 2062174 1209395 ~ 1211232 (+)
G430452 NA other upstream 2129793 1150597 ~ 1150938 (+)
G430409 NA other upstream 2280829 925544 ~ 999902 (+)
CI01000306_03772689_03777211 DYNLRB1 other downstream 493154 3772689 ~ 3777550 (+)
CI01000306_03778075_03781910 MAP1LC3A, MAP1LC3A.L other downstream 497062 3778052 ~ 3783019 (+)
CI01000306_03807268_03810946 NA other downstream 527243 3807268 ~ 3811243 (+)
G432583 NA other downstream 1045412 4326402 ~ 4327822 (+)
G432678 NA other downstream 1241192 4522182 ~ 4522536 (+)

Expression


Co-expression Network