G431243



Basic Information


Item Value
gene id G431243
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 3788979 ~ 3789321 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU495129
TTTTCTTTGAAGCCTGTCGTTCTCATAACCACTCAGTGGGCAAGTGCCTTGTAATCTAATTTTACACTCCTGCACCCGAAAGCAACCATAAATGTAAAAGTAAAACAGAACAGAAAGTCCTGGTTGGGTGATGTAAGGCGTTTAAAAGAGTTTATTTGGATGAACTTGTGCCCCTGCGAATTAAAATGTCTTATTAAGTATTTTAATCTCTGATACGTATTTTAACTGCTGAGTTACTATGTGTGTTTAATGTGTTCAATGTGACTCTGCTCAAATGAATCCAAATATTTAGTTATGTCAATTCACCTCTATGTTCTTTTCCAAAAATGCATAGGTATTTCTG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU495129 True 343 lncRNA 0.35 1 3788979 3789321
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000306_03778075_03781910 MAP1LC3A, MAP1LC3A.L coding upstream 6937 3778052 ~ 3783019 (+)
CI01000306_03772689_03777211 DYNLRB1 coding upstream 11456 3772689 ~ 3777550 (+)
CI01000306_03704267_03746574 UNM_SA1614 coding upstream 42058 3704267 ~ 3746921 (+)
CI01000306_03677906_03697637 NA coding upstream 91187 3677906 ~ 3697792 (+)
CI01000306_03666143_03671601 NA coding upstream 116304 3666143 ~ 3672675 (+)
CI01000306_03807268_03810946 NA coding downstream 17947 3807268 ~ 3811243 (+)
CI01000306_03827847_03828735 NA coding downstream 36416 3825737 ~ 3828845 (+)
CI01000306_03889176_03889334 NA coding downstream 99027 3888348 ~ 3889371 (+)
CI01000306_04050451_04054257 NA coding downstream 261011 4050332 ~ 4054402 (+)
CI01000306_04077126_04078242 NA coding downstream 287805 4077126 ~ 4078531 (+)
G431231 NA non-coding upstream 17583 3771158 ~ 3771396 (+)
G431228 NA non-coding upstream 18733 3769997 ~ 3770246 (+)
G431226 NA non-coding upstream 21586 3767162 ~ 3767393 (+)
G431134 NA non-coding upstream 192610 3538785 ~ 3596369 (+)
G431130 NA non-coding upstream 251524 3532604 ~ 3537455 (+)
G431242 NA non-coding downstream 1455 3790776 ~ 3791987 (+)
G431249 NA non-coding downstream 8350 3797671 ~ 3797894 (+)
G431251 NA non-coding downstream 10895 3800216 ~ 3800611 (+)
G431252 NA non-coding downstream 11313 3800634 ~ 3800857 (+)
G431238 NA non-coding downstream 13929 3803250 ~ 3803641 (+)
CI01000306_02974291_02976718 TP53INP2 other upstream 809822 2973156 ~ 2979157 (+)
G430719 NA other upstream 1638025 2148382 ~ 2150954 (+)
CI01000306_01209847_01210850 ACYP2 other upstream 2570422 1209395 ~ 1211232 (+)
G432583 NA other downstream 537081 4326402 ~ 4327822 (+)
G432678 NA other downstream 732861 4522182 ~ 4522536 (+)
G432958 NA other downstream 1869607 5658928 ~ 5660169 (+)
CI01000306_05976516_05985251 TMEM178A, TMEM178 other downstream 2191192 5975822 ~ 5986288 (+)

Expression


G431243 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G431243 Expression in each Bioproject

Bar chart with 12 bars.
G431243 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network