G432586


Basic Information

Item Value
gene id G432586
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 4418192 ~ 4419629 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU496732
TGTGGAGGGGTGGGCGTGGAGGACAGATGTCCTGTGGGAGGGGTTGGTGTCGAAGAGGGCCGTCCTGAAGGTGGGGTTAAGGTAGAGGCTGGGTGCCCAGCAGGAGGAGTAGGATTCCGGCTTCCAAACATGATTTCCTCCGTGATGTCCTTACCACCCTGATTGGGGTCTCGAATCCGGATCTGTGAGGATGGTTTCTTTTCACGCTTGACTGGTGGAGGTGGCAGTTGTGCAGGCACTATGATGGGTGGAGAGGGAGGGTACACTGTCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU496732 True 271 lncRNA 0.57 2 4418192 4419629

Neighbor

gene id symbol gene type direction distance location
CI01000306_04253810_04255748 BARX1 coding upstream 161351 4253163 ~ 4256841 (+)
CI01000306_04111278_04162816 FBLN2 coding upstream 254348 4110793 ~ 4163844 (+)
CI01000306_04077126_04078242 NA coding upstream 339661 4077126 ~ 4078531 (+)
CI01000306_04050451_04054257 NA coding upstream 363790 4050332 ~ 4054402 (+)
CI01000306_03889176_03889334 NA coding upstream 528821 3888348 ~ 3889371 (+)
CI01000306_04454619_04454783 NA coding downstream 34990 4454619 ~ 4455552 (+)
CI01000306_04489350_04503649 ALPL coding downstream 69721 4489350 ~ 4505749 (+)
CI01000306_04570147_04574537 NMUR3 coding downstream 150154 4569783 ~ 4574728 (+)
CI01000306_04686121_04753101 EPHB2, EPHB2B coding downstream 266492 4686121 ~ 4753101 (+)
CI01000306_04789240_04793134 LRRC38, LRRC38A coding downstream 368541 4788170 ~ 4794154 (+)
G432568 NA non-coding upstream 55961 4360581 ~ 4362231 (+)
G432571 NA non-coding upstream 70321 4345029 ~ 4347871 (+)
G432629 NA non-coding upstream 110499 4307346 ~ 4307693 (+)
G432628 NA non-coding upstream 110852 4307121 ~ 4307340 (+)
G432627 NA non-coding upstream 111322 4306649 ~ 4306870 (+)
G432556 NA non-coding downstream 36506 4456135 ~ 4506862 (+)
G432672 NA non-coding downstream 89810 4509439 ~ 4509709 (+)
G432680 NA non-coding downstream 110688 4530317 ~ 4530526 (+)
G432697 NA non-coding downstream 147981 4567610 ~ 4567836 (+)
G432703 NA non-coding downstream 160968 4580597 ~ 4586360 (+)
G432583 NA other upstream 90370 4326402 ~ 4327822 (+)
CI01000306_03807268_03810946 NA other upstream 609194 3807268 ~ 3811243 (+)
CI01000306_03778075_03781910 MAP1LC3A, MAP1LC3A.L other upstream 635173 3778052 ~ 3783019 (+)
CI01000306_03772689_03777211 DYNLRB1 other upstream 640642 3772689 ~ 3777550 (+)
CI01000306_02974291_02976718 TP53INP2 other upstream 1439035 2973156 ~ 2979157 (+)
G432678 NA other downstream 102553 4522182 ~ 4522536 (+)
G432958 NA other downstream 1239299 5658928 ~ 5660169 (+)
CI01000306_05976516_05985251 TMEM178A, TMEM178 other downstream 1560884 5975822 ~ 5986288 (+)
CI01000306_06106248_06107449 GM2573, CS056, WDR83OS other downstream 1686514 6106143 ~ 6108175 (+)
G433724 NA other downstream 1688982 6108611 ~ 6129778 (+)

Expression


Co-expression Network