G432925


Basic Information

Item Value
gene id G432925
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 5246325 ~ 5246557 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU497098
GTTTTACTGAGTTTAACGGCTCTGGCTGAGCTGTGATATAAACGAAACGCTATTGGCTATTTTTTTTTAAAAGGGGCGGAGCTGTTCGATATATTGCCCTGTCTTCCTGTTTCAGTTGAAATTACGTCAACACATTGAATAATGCTGCACGTTCCAAGACACTTCAGCGGGCCTTTAAACCCTTGCTCTGACTCTGCATGTTTTGATAGCATGTTCTTGTTGAAGAAATTACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU497098 True 233 lncRNA 0.41 1 5246325 5246557

Neighbor

gene id symbol gene type direction distance location
CI01000306_04958429_04977273 NA coding upstream 268907 4958341 ~ 4977418 (+)
CI01000306_04863197_04868703 NA coding upstream 377531 4863197 ~ 4868794 (+)
CI01000306_04859604_04861501 NA coding upstream 384755 4859538 ~ 4861570 (+)
CI01000306_04789240_04793134 LRRC38, LRRC38A coding upstream 452171 4788170 ~ 4794154 (+)
CI01000306_04686121_04753101 EPHB2, EPHB2B coding upstream 493224 4686121 ~ 4753101 (+)
CI01000306_05358831_05362667 NA coding downstream 112274 5358831 ~ 5362710 (+)
CI01000306_05368199_05371572 NA coding downstream 121357 5367914 ~ 5371880 (+)
CI01000306_05390270_05392867 NA coding downstream 143016 5389573 ~ 5393074 (+)
CI01000306_05399614_05410516 NA coding downstream 152757 5399314 ~ 5410886 (+)
CI01000306_05456160_05473514 NA coding downstream 209603 5456160 ~ 5473514 (+)
G432918 NA non-coding upstream 6854 5239247 ~ 5239471 (+)
G432912 NA non-coding upstream 23007 5222818 ~ 5223318 (+)
G432907 NA non-coding upstream 33236 5212791 ~ 5213089 (+)
G432795 NA non-coding upstream 301561 4944532 ~ 4944764 (+)
G432768 NA non-coding upstream 383702 4862328 ~ 4862623 (+)
G432902 NA non-coding downstream 1663 5248220 ~ 5249076 (+)
G432903 NA non-coding downstream 2695 5249252 ~ 5251194 (+)
G432905 NA non-coding downstream 15878 5262435 ~ 5263344 (+)
G432927 NA non-coding downstream 18406 5264963 ~ 5265223 (+)
G432933 NA non-coding downstream 38237 5284794 ~ 5285109 (+)
G432678 NA other upstream 723789 4522182 ~ 4522536 (+)
G432583 NA other upstream 918503 4326402 ~ 4327822 (+)
CI01000306_03807268_03810946 NA other upstream 1437327 3807268 ~ 3811243 (+)
CI01000306_03778075_03781910 MAP1LC3A, MAP1LC3A.L other upstream 1463306 3778052 ~ 3783019 (+)
CI01000306_03772689_03777211 DYNLRB1 other upstream 1468775 3772689 ~ 3777550 (+)
G432958 NA other downstream 412371 5658928 ~ 5660169 (+)
CI01000306_05976516_05985251 TMEM178A, TMEM178 other downstream 733956 5975822 ~ 5986288 (+)
CI01000306_06106248_06107449 GM2573, CS056, WDR83OS other downstream 859586 6106143 ~ 6108175 (+)
G433724 NA other downstream 862054 6108611 ~ 6129778 (+)
G434545 NA other downstream 1872760 7119317 ~ 7119859 (+)

Expression


Co-expression Network