G433486


Basic Information

Item Value
gene id G433486
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 5319625 ~ 5320279 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU497721
GGGCGTTGTTAGGCACAACGATACAGCACTAGCCTCAAGTACCTTATTGCTTTTATAAAACGGTTACCACACAATACAAATATTAAAGCCAAAAATATGTATCAATGCAACTTTCATGAAGTAAACTTTCACTAAAGCCCTCCTTCCGCTGGAAAAAATAGTCCCTGACCATGAACAGCTACAGAAGTTACATTATTACGCCATTAGATGGCGGCAAAGACTGTCTTTATGAGTGAGTCACTCAGTAGCGAAGACTTTTACATTGAAAAGACTGAATTGTTGTGAACACGGAACAAGACGCAACTGACAAATGCTTTGACTAGCGCTGTCAGTCACGGGAAAACACCTTAACTGTTAAAAGGACAGGATAATACATCGGACATTTAAACTTATTTTTTTATTATGAACATAGGACTGACCTGAATGAAAATGCTAAATCTGAATGCAGGTAATAAACTCGCTCATCTTTTTCTCACAATACTCTTCTACATAATACAGTAAGCTTCAATGAACAATATCAATTGAGAACATGCAGTTTACCTTGCTAAGAGTGGTGTAGTGATACACAGAACCGTTGGGTGAAGCGGTCATAGCCATGTTTTATCATGAATAAAACACAGCTATTGACCAATCAGAATCAAGGACAGGAGCTAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU497721 True 655 lncRNA 0.38 1 5319625 5320279

Neighbor

gene id symbol gene type direction distance location
CI01000306_05007257_05008896 NA coding downstream 310729 5006631 ~ 5008896 (-)
CI01000306_04883506_04908414 NA coding downstream 410105 4883403 ~ 4909520 (-)
CI01000306_04870702_04872912 KLHDC7A coding downstream 446688 4870528 ~ 4872937 (-)
CI01000306_04848327_04856522 DHRS3B, DHRS3, DHRS3A coding downstream 463103 4848327 ~ 4856522 (-)
CI01000306_04806459_04809719 NA coding downstream 509374 4805842 ~ 4810251 (-)
CI01000306_05414347_05434965 CHD5 coding upstream 93992 5414271 ~ 5434965 (-)
CI01000306_05452986_05453456 RPL22 coding upstream 132585 5452864 ~ 5453456 (-)
CI01000306_05476895_05478400 NR0B1 coding upstream 156117 5476396 ~ 5478565 (-)
CI01000306_05506906_05508492 NA coding upstream 186385 5506132 ~ 5508657 (-)
CI01000306_05520026_05523437 PLEKHA3 coding upstream 199713 5519992 ~ 5523437 (-)
G433485 NA non-coding downstream 369 5318987 ~ 5319256 (-)
G433482 NA non-coding downstream 2552 5316857 ~ 5317073 (-)
G433481 NA non-coding downstream 4282 5314817 ~ 5315343 (-)
G433477 NA non-coding downstream 44918 5274485 ~ 5274707 (-)
G433476 NA non-coding downstream 53863 5265537 ~ 5265762 (-)
G433487 NA non-coding upstream 1745 5322024 ~ 5322271 (-)
G433504 NA non-coding upstream 141254 5461533 ~ 5461751 (-)
G433532 NA non-coding upstream 154842 5475121 ~ 5475405 (-)
G433536 NA non-coding upstream 170656 5490935 ~ 5491156 (-)
G433539 NA non-coding upstream 177695 5497974 ~ 5498184 (-)
CI01000306_04544349_04545034 NA other downstream 774533 4542723 ~ 4545244 (-)
G432022 NA other downstream 2315734 3000236 ~ 3003891 (-)
CI01000306_01723684_01726043 MAFGA, MAFGB, MAFG other downstream 3570675 1717933 ~ 1726043 (-)
G431814 NA other downstream 4007191 1311702 ~ 1312434 (-)
G431706 NA other downstream 4156287 1163027 ~ 1163338 (-)
G433450 NA other upstream 41364 5361643 ~ 5383763 (-)
G433670 NA other upstream 720735 6041014 ~ 6041283 (-)
G433985 NA other upstream 875828 6196107 ~ 6197210 (-)
G434016 NA other upstream 1034901 6355180 ~ 6361643 (-)
G434086 NA other upstream 1117127 6437406 ~ 6452251 (-)

Expression


Co-expression Network