G433541



Basic Information


Item Value
gene id G433541
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 5499341 ~ 5499574 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU497779
GAAAAGGTAAGTCTTTTTTTCACACTAAAACCATGTAAACACACTATACTATTGAAACAGCGAGTATTTAATGCTAAATGATTGGCCTCATTCACTTCCATTTAAAGTGCTTCACTGTAACCTAACCCTAAAATCTAATAGAAACTTATAGAAACTTAACACCTTTGGACAAACGCAACATGTGCACGTACAAGACAGTGAGTTTAATTATACAGTTTACATCAATGTTTCTGC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU497779 True 234 lncRNA 0.33 1 5499341 5499574

Neighbor


gene id symbol gene type direction distance location
CI01000306_05476895_05478400 NR0B1 coding downstream 20776 5476396 ~ 5478565 (-)
CI01000306_05452986_05453456 RPL22 coding downstream 45885 5452864 ~ 5453456 (-)
CI01000306_05414347_05434965 CHD5 coding downstream 64376 5414271 ~ 5434965 (-)
CI01000306_05250669_05357112 ARHGEF10L, ARHGEF10LA coding downstream 142229 5250669 ~ 5357112 (-)
CI01000306_05007257_05008896 NA coding downstream 490445 5006631 ~ 5008896 (-)
CI01000306_05506906_05508492 NA coding upstream 7090 5506132 ~ 5508657 (-)
CI01000306_05520026_05523437 PLEKHA3 coding upstream 20418 5519992 ~ 5523437 (-)
CI01000306_05544881_05552941 CYBB, GP91PHOX coding upstream 44938 5544512 ~ 5552941 (-)
CI01000306_05555926_05562924 XK coding upstream 56352 5555926 ~ 5562949 (-)
CI01000306_05606914_05611346 FIGF, VEGFD coding upstream 107031 5606605 ~ 5611346 (-)
G433539 NA non-coding downstream 1157 5497974 ~ 5498184 (-)
G433536 NA non-coding downstream 8185 5490935 ~ 5491156 (-)
G433532 NA non-coding downstream 23936 5475121 ~ 5475405 (-)
G433504 NA non-coding downstream 37590 5461533 ~ 5461751 (-)
G433487 NA non-coding downstream 177070 5322024 ~ 5322271 (-)
G433527 NA non-coding upstream 18256 5517830 ~ 5518379 (-)
G433550 NA non-coding upstream 25594 5525168 ~ 5526352 (-)
G433518 NA non-coding upstream 63844 5563418 ~ 5563669 (-)
G433561 NA non-coding upstream 68341 5567915 ~ 5590563 (-)
G433450 NA other downstream 115578 5361643 ~ 5383763 (-)
CI01000306_04544349_04545034 NA other downstream 954249 4542723 ~ 4545244 (-)
G432022 NA other downstream 2495450 3000236 ~ 3003891 (-)
CI01000306_01723684_01726043 MAFGA, MAFGB, MAFG other downstream 3750391 1717933 ~ 1726043 (-)
G431814 NA other downstream 4186907 1311702 ~ 1312434 (-)
G433670 NA other upstream 541440 6041014 ~ 6041283 (-)
G433985 NA other upstream 696533 6196107 ~ 6197210 (-)
G434016 NA other upstream 855606 6355180 ~ 6361643 (-)
G434086 NA other upstream 937832 6437406 ~ 6452251 (-)
G434338 NA other upstream 1367082 6866656 ~ 6866936 (-)

Expression



Co-expression Network